Entry information : SmPrx55-1_5 (SmPrx55a_5)
Entry ID 1750
Creation 2008-07-01 (Christophe Dunand)
Last sequence changes 2011-01-25 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx55-1_5 (SmPrx55a_5)
Name (synonym) SmPrx55-1_5 (SmPrx55a_5)
Class Class III peroxidase    [Orthogroup: Prx028]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type Callus
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx55-1_5
start..stop
S start..stop
SmPrx55-2_1 671 0 1..335 1..335
SmPrx52-2_1 402 2e-141 26..334 40..346
SmPrx52-1_16 402 5e-141 30..334 45..346
ApuncPrx14 357 7e-124 38..334 19..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2139209..2139457 249 N° 2 2139518..2139872 355 N° 3 2139938..2140341 404  
join(2139209..2139457,2139518..2139872,2139938..2140341)


exon

Literature and cross-references SmPrx55-1_5 (SmPrx55a_5)
Literature JGI
DNA ref. Phytozome 12:   scaffold_5 (2139209..2140341)
mRNA ref. JGI transcript:   167284
EST ref. GenBank:   FE517362.1 [3' end]
Protein sequence: SmPrx55-1_5 (SmPrx55a_5)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (314)
PWM (Da):   %s   36092.32 (33817.1)  
PI (pH):   %s   6.73 (6.26) Peptide Signal:   %s   cut: 22 range:22-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTRQTLVLLVCSVFLLGLSNSEYYSVDTFGGNGFSKGLRFGFYAATCPNVETIVRESFTSNIFRDPTAAGALIRLAFHDCQVGGCDASILLSSSESITSELVSDRNFGIRRLDFIDSIKSALEASCPGVVSCADIIALAARDSIRISGGPNIPILLGRRDSTSASNLAADRSIPLPTISVDDTISLFQSKGMTLQETVAILGAHTVGVGHCVSVLDRLYPTQDPNLLPPRSAQLRAQCPPTPPQLLNNNTFFANDFTNVFFDNQYFRDILNGQGLFGIDSKIALDKRTSRIVSMFATNQAYFFAVFSSAFNKMLASNVLTGSSGEIRRDCKVVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 3) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACACGGCAAACGCTAGTTCTTCTCGTCTGCTCGGTGTTTTTACTCGGCCTGTCCAACTCCGAGTACTACTCAGTCGACACTTTCGGTGGTAACGGGTTTTCAAAAGGACTGAGGTTT
GGATTCTATGCAGCTACTTGTCCAAACGTGGAAACCATTGTCCGGGAGTCTTTCACTAGCAATATCTTTCGAGACCCGACTGCTGCCGGTGCTCTCATTCGTTTGGCGTTCCACGATTGC
CAAGTCGGG
GTACGTAGATGTTTTCCTACAATCTTAACAGTTTTGGCCAACTTTTCTGTGCTTCTCCAGGGCTGTGACGCGTCCATCCTGCTCAGCTCCTCCGAGTCGATCACCAGCGAG
CTCGTCTCCGATAGAAACTTTGGAATCCGTCGACTGGATTTCATTGACAGCATCAAGAGCGCGCTCGAAGCGTCGTGCCCGGGTGTGGTTTCCTGTGCGGACATCATAGCCTTGGCTGCA
AGAGACTCCATCAGGATCTCGGGGGGACCAAACATTCCCATACTCCTCGGACGAAGGGACTCCACAAGCGCCAGTAACTTAGCGGCCGATCGATCCATTCCACTCCCAACTATCAGCGTC
GACGACACCATCAGCCTGTTCCAGTCCAAAGGCATGACGCTCCAAGAAACAGTGGCCATTCTAG
GTACTCCTACTTCCAAATTCCCACTGCTGCTCGAGCTCTTTTCTTCGCTCTTTTCT
TGTTTGTAGGTGCTCACACTGTTGGTGTTGGCCACTGCGTAAGCGTCCTGGATCGATTGTATCCAACGCAAGACCCGAACTTGCTCCCTCCTCGCTCAGCGCAGCTCCGAGCTCAGTGTC
CTCCCACTCCGCCACAGCTCCTCAACAACAACACCTTCTTCGCCAATGACTTCACCAACGTGTTCTTCGACAACCAGTACTTCAGAGACATTCTCAATGGGCAGGGGCTGTTTGGAATCG
ACTCAAAGATCGCGCTTGACAAGAGAACCTCCCGGATTGTCTCCATGTTTGCGACGAACCAGGCGTACTTCTTTGCGGTCTTCTCCTCGGCGTTTAATAAGATGCTGGCGTCCAACGTTC
TCACGGGTAGCAGTGGAGAGATTAGAAGAGATTGCAAGGTTGTCAACTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACACGGCAAACGCTAGTTCTTCTCGTCTGCTCGGTGTTTTTACTCGGCCTGTCCAACTCCGAGTACTACTCAGTCGACACTTTCGGTGGTAACGGGTTTTCAAAAGGACTGAGGTTT
GGATTCTATGCAGCTACTTGTCCAAACGTGGAAACCATTGTCCGGGAGTCTTTCACTAGCAATATCTTTCGAGACCCGACTGCTGCCGGTGCTCTCATTCGTTTGGCGTTCCACGATTGC
CAAGTCGGG
GGCTGTGACGCGTCCATCCTGCTCAGCTCCTCCGAGTCGATCACCAGCGAGCTCGTCTCCGATAGAAACTTTGGAATCCGTCGACTGGATTTCATTGACAGCATCAAGAGC
GCGCTCGAAGCGTCGTGCCCGGGTGTGGTTTCCTGTGCGGACATCATAGCCTTGGCTGCAAGAGACTCCATCAGGATCTCGGGGGGACCAAACATTCCCATACTCCTCGGACGAAGGGAC
TCCACAAGCGCCAGTAACTTAGCGGCCGATCGATCCATTCCACTCCCAACTATCAGCGTCGACGACACCATCAGCCTGTTCCAGTCCAAAGGCATGACGCTCCAAGAAACAGTGGCCATT
CTAG
GTGCTCACACTGTTGGTGTTGGCCACTGCGTAAGCGTCCTGGATCGATTGTATCCAACGCAAGACCCGAACTTGCTCCCTCCTCGCTCAGCGCAGCTCCGAGCTCAGTGTCCTCCC
ACTCCGCCACAGCTCCTCAACAACAACACCTTCTTCGCCAATGACTTCACCAACGTGTTCTTCGACAACCAGTACTTCAGAGACATTCTCAATGGGCAGGGGCTGTTTGGAATCGACTCA
AAGATCGCGCTTGACAAGAGAACCTCCCGGATTGTCTCCATGTTTGCGACGAACCAGGCGTACTTCTTTGCGGTCTTCTCCTCGGCGTTTAATAAGATGCTGGCGTCCAACGTTCTCACG
GGTAGCAGTGGAGAGATTAGAAGAGATTGCAAGGTTGTCAACTCGTAA

Retrieve as FASTA