Entry information : SmPrx25-1_80 (SmPrx25a_80)
Entry ID 1751
Creation 2008-07-01 (Christophe Dunand)
Last sequence changes 2008-07-01 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: SmPrx25-1_80 (SmPrx25a_80)
Name (synonym) SmPrx25-1_80 (SmPrx25a_80)
Class Class III peroxidase    [Orthogroup: Prx279]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type Callus
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx25-1_80
start..stop
S start..stop
SmPrx25-2_30 655 0 1..321 1..321
SmPrx52-1_16 388 7e-136 1..321 26..346
SmPrx52-2_1 387 2e-135 1..321 26..346
SmPrx12-1_113 348 2e-120 4..321 5..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 263408..263617 210 N° 2 263684..264038 355 N° 3 264106..264506 401  
join(263408..263617,263684..264038,264106..264506)


exon

Literature and cross-references SmPrx25-1_80 (SmPrx25a_80)
Literature JGI.
DNA ref. Phytozome 12:   scaffold_80 (263408..264506)
mRNA ref. JGI transcript:   125747 [Incorrect prediction]
EST ref. GenBank:   FE463769 [5' end]   FE499116 [3' end]
Protein sequence: SmPrx25-1_80 (SmPrx25a_80)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (298)
PWM (Da):   %s   33885.07 (31241.8)  
PI (pH):   %s   5.29 (5.62) Peptide Signal:   %s   cut: 24 range:24-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDLWLSAFWFWLTLSGLLSGTMSQLRAGFYDLTCPRVESIVRTTMTPNLMADPTAAAALVRAAFHDCQVGGCDASILLTSAGAITSEQESDKNFGIRGLNVIDRVKTAVEFWCPGVVSCADIVVLAARDAITMGGGPTIDVLLGRRDSRFASNAQADSSLPPATITVPAMLDMFKAKGITPEEGVALIGAHTIGVSHCVSFVNRLYPSRDSAMGLVYAGRLGLSCPTGNPVLINNLTVVANDNTNLIFDNQYFRDVSSGMGLLTIDAELGVHPATSGIVALYAQNQKAFFDAFTAGFLKLTSHTVLTGDSGEIRRSCGSLN

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 3) and 22 ESTs. Incorrect prediction from JGI (PS is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCTCTGGTTGTCTGCATTCTGGTTTTGGCTTACTTTGAGTGGCTTGCTGTCGGGAACAATGTCACAGCTGAGAGCCGGCTTCTACGATCTCACTTGCCCTCGAGTGGAGAGCATT
GTTCGAACGACTATGACTCCGAACTTGATGGCGGATCCCACTGCAGCGGCGGCACTCGTTCGAGCAGCATTCCACGACTGCCAAGTTGGA
GTAAGTCTGTTTTTCTATGACGCTATCTAT
ATACCGGTATTGATCTGGGCTTGTTTCGTGACGCAGGGCTGTGACGCATCGATTCTTCTAACTTCGGCTGGAGCAATCACCAGCGAGCAGGAGTCTGACAAGAACTTTGGAATTCGGGGG
CTGAATGTGATCGACAGGGTAAAGACTGCTGTTGAGTTCTGGTGTCCCGGAGTGGTGTCGTGCGCGGACATAGTGGTCCTGGCCGCCCGGGATGCGATCACTATGGGAGGAGGTCCGACC
ATAGATGTGTTACTAGGCAGGAGGGACAGCCGGTTTGCAAGCAATGCTCAAGCAGACAGTTCTCTTCCACCGGCAACCATCACAGTTCCGGCAATGCTCGACATGTTCAAGGCGAAAGGC
ATCACTCCGGAGGAAGGTGTCGCTCTCATAG
GTGAGTCGAGCTTTTCCTTTTTCTAAATAGAAGTTGTTCCTGATGAAATGAGTGAATGATCTTCTAGGTGCTCATACAATCGGAGTGTC
ACACTGCGTGAGCTTCGTGAATCGTTTATATCCCAGTAGGGACTCCGCAATGGGATTGGTGTACGCTGGAAGGTTGGGCTTGAGCTGCCCGACTGGGAACCCCGTACTCATCAACAACTT
AACCGTGGTAGCCAACGATAACACCAATCTCATCTTCGACAACCAGTACTTCCGGGACGTGAGCAGCGGAATGGGGCTGCTGACGATCGACGCGGAGCTGGGAGTGCATCCAGCGACGTC
CGGGATCGTCGCCCTTTACGCCCAGAACCAAAAGGCCTTCTTCGACGCGTTCACCGCGGGGTTCCTCAAGCTCACGTCTCACACGGTGCTCACCGGCGACAGTGGCGAGATACGACGAAG
CTGTGGATCTCTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCTCTGGTTGTCTGCATTCTGGTTTTGGCTTACTTTGAGTGGCTTGCTGTCGGGAACAATGTCACAGCTGAGAGCCGGCTTCTACGATCTCACTTGCCCTCGAGTGGAGAGCATT
GTTCGAACGACTATGACTCCGAACTTGATGGCGGATCCCACTGCAGCGGCGGCACTCGTTCGAGCAGCATTCCACGACTGCCAAGTTGGA
GGCTGTGACGCATCGATTCTTCTAACTTCG
GCTGGAGCAATCACCAGCGAGCAGGAGTCTGACAAGAACTTTGGAATTCGGGGGCTGAATGTGATCGACAGGGTAAAGACTGCTGTTGAGTTCTGGTGTCCCGGAGTGGTGTCGTGCGCG
GACATAGTGGTCCTGGCCGCCCGGGATGCGATCACTATGGGAGGAGGTCCGACCATAGATGTGTTACTAGGCAGGAGGGACAGCCGGTTTGCAAGCAATGCTCAAGCAGACAGTTCTCTT
CCACCGGCAACCATCACAGTTCCGGCAATGCTCGACATGTTCAAGGCGAAAGGCATCACTCCGGAGGAAGGTGTCGCTCTCATAG
GTGCTCATACAATCGGAGTGTCACACTGCGTGAGC
TTCGTGAATCGTTTATATCCCAGTAGGGACTCCGCAATGGGATTGGTGTACGCTGGAAGGTTGGGCTTGAGCTGCCCGACTGGGAACCCCGTACTCATCAACAACTTAACCGTGGTAGCC
AACGATAACACCAATCTCATCTTCGACAACCAGTACTTCCGGGACGTGAGCAGCGGAATGGGGCTGCTGACGATCGACGCGGAGCTGGGAGTGCATCCAGCGACGTCCGGGATCGTCGCC
CTTTACGCCCAGAACCAAAAGGCCTTCTTCGACGCGTTCACCGCGGGGTTCCTCAAGCTCACGTCTCACACGGTGCTCACCGGCGACAGTGGCGAGATACGACGAAGCTGTGGATCTCTC
AACTGA

Retrieve as FASTA