Entry information : HaPrx17 (HanXRQChr01g0013211)
Entry ID 1873
Creation 2005-09-27 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx17 (HanXRQChr01g0013211)
Name (synonym) HaPrx17 (HanXRQChr01g0013211)
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx17
start..stop
S start..stop
HargPrx06 648 0 1..322 1..322
LvPrx34 547 0 3..322 4..321
LperPrx34 502 0 1..294 1..296
HaPrx38 502 0 1..322 23..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 81191006..81191221 216 N° 2 81191326..81191517 192 N° 3 81192794..81193354 561  
join(81191006..81191221,81191326..81191517,81192794..81193354)


exon

Literature and cross-references HaPrx17 (HanXRQChr01g0013211)
Literature Kozik,A., Michelmore,R.W., Knapp,S., Matvienko,M., Rieseberg,L.,
Lin,H., van Damme,M., Lavelle,D., Chevalier,P., Ziegle,J., Ellison,P., Kolkman,J., Slabaugh,M.S., Livingston,K., Zhou,Y., Lai,Z., Church,S., Jackson,L. and Bradford,K. Lettuce and Sunflower ESTs from the Compositae Genome Project
DNA ref. HanXRQ genome:   HanXRQChr01 (81191006..81193354)
EST ref. GenBank:   BQ969478.1 [5' end]
Cluster/Prediction ref. HanXRQ:   HanXRQChr01g0013211
Protein sequence: HaPrx17 (HanXRQChr01g0013211)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (297)
PWM (Da):   %s   34464.42 (31934.1)  
PI (pH):   %s   9.66 (9.66) Peptide Signal:   %s   cut: 26 range:26-322
Sequence 363
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSILISFALLASTLFFMSGPSSAQLTPNFYSKSCPKVFDVVGSVVRAAVAKEKRMGASLLRLHFHDCFVNGCDGSILLDDTSSFTGEKTARPNVNSVRGFNVIDDVKKKVEGVCPGVVSCADILAISALESMLALGGPEWTVKLGRRDSKTASFSAANSGVIPPPTSTLSNLINRFQAVGLSTRDMVALSGAHTIGQARCTTFRARIYNDTNIDAAFARSRRSNCPRPSGSGDNNLAPLDVKTPNSFDNAYYGNLISQKGLLRSDQQLHNGGSTDSLVEQYNKNPRSFYADFAAAMVRMGDIRPLTGRNGEIRKNCRVPN

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTCTTCTATTCTCATCTCCTTTGCATTGCTTGCTTCTACCTTGTTCTTCATGAGTGGTCCCTCTTCAGCCCAACTCACTCCCAACTTCTACTCAAAAAGTTGCCCGAAGGTTTTTG
ATGTTGTCGGCTCAGTGGTTAGGGCCGCTGTAGCCAAGGAGAAACGCATGGGTGCATCTCTCCTTAGGCTCCATTTCCACGATTGTTTTGTAAAT
GTATGTATCTTAATTTCTCTCTCTA
TTTGACTTGATTATCGTGTTAAGAGTTACTTGTTTGGTGATAATATATAGTTAACGTTTAAAAATTCTTGTTTTTGTAGGGGTGTGACGGGTCCATTCTACTAGATGACACATCTTCGTT
CACTGGAGAAAAGACTGCCAGGCCGAATGTGAATTCGGTTAGGGGTTTTAATGTGATTGATGATGTAAAGAAGAAGGTTGAAGGAGTTTGTCCCGGTGTTGTCTCTTGTGCTGATATACT
GGCGATTTCTGCTCTTGAATCCATGCTTGCT
GTAAGTATAACTTGATGCGTCGCTATATAGTTATGTAGTGTTGAGCTATATATCACCCTTTCTGTCACAACTCACAAAGTATATAATAT
GTTAACATGGTCTTGTAAGCTCGTTTTCATAACATGATATGTTAACATAAATGCAAGGTTACTAGCCTAGCTAGGGAGAATAGCCAATCGACCAAACTAAATTAATAAGAGTCTCTAAAA
CTGATTAAGTAACCAATGATGAAACCTTAATTGGTCAAAGGGTTATCATAATTTATCCTATTTACCGACTAGTCAAACTTATGTATATTAAATTTTAAAAAATGAAAGAAAAAGAAACGA
CTAAAATCAATGTCTTTCAAGTTTTAAATATAAACAATAATAAACTAACTTTTCATCCACTAAAATATATTTAATTATTTATCATAAGAGCATATGAGTTGTGGGGGGCTAAGCATGAGT
TGGGGGGGCTAAGCCATAACAAAAGAGCTGTGAAGGCGATGAATGTGGAAGTTCTTGCGGGCGTGGAGCACTTTTTTTTTTTTAATTAGTTAGTTAAACAAAAATAAGCAGTCGTATAGA
ACCATCTCATTCCACCATCACATGTTAGGGATTTTTTTTTTTCATATTTCATATTCACAAAAACATAGCCTATTATAATTTAATTTAGTATAGAGAAAGTTACCAAAATAGATAACTTCG
ACAAAAAATTTTATTCCAAAATAGACAAAACTCCTTAGCCTATTTAATATAGAGAAAGTTACCAAAATAGATAACTTTGACAAAAAAAAATTTATTCCAAAATCGACAAAACTCCTTAGC
CTTTTCAAAACGAATTAAACCAATCAAAATACGATACGTCAACTCCATCAACAGAGACTACTAGTATTTAGCTGCCGCTGGCTAAGGGATTTTCTAGTGTTTAGTCGGCGCCTAGCTAGG
GCTTATTTTATTGTTTAGCCGGCGGCTAGAAGCTTAGCCCGTACTTTCTTTTTGTTTAGTTGGTGGCTAACTTGATTACTTTAGAATCGGCTAAATATGTTGTCTAATGTTGTCTATTTT
GAATTTTTTTTTTTTTTGGTAAAAATATGTAATTTTGCCTTTAATTAATATATAACATAGTGATTTAGTTCTGTTGAAATGATTGGTGTCGGCATCAATACCAGTAACCACATCCAATAA
CTGTTCCAAAAAACAATGTTTTGATTTAACAGATTTGTCCGTAACAAAAAAAAAATAAAAATAAAAAAATAACACTAGTAAACTGATGTTACACAATTTGTCTAAAGTTAGGTGGGCCTG
AATGGACAGTCAAGTTAGGAAGAAGAGACTCCAAAACAGCCAGCTTCTCCGCGGCAAACAGCGGCGTTATTCCGCCACCAACATCCACCCTCAGCAACCTCATCAACCGCTTCCAAGCCG
TCGGTCTATCCACTAGAGACATGGTGGCACTCTCGGGTGCACACACAATCGGACAAGCACGATGCACCACATTTAGAGCACGTATTTACAACGACACCAACATTGATGCCGCATTCGCCA
GATCACGCAGATCAAACTGCCCTCGTCCATCCGGCTCAGGCGACAACAACCTTGCACCACTTGACGTTAAAACGCCCAACAGTTTCGATAACGCTTATTATGGGAATTTAATTAGCCAAA
AGGGTTTGCTTCGGTCGGACCAGCAGTTGCACAATGGTGGCTCCACCGATTCGTTGGTGGAGCAGTACAACAAAAATCCGCGTAGTTTCTATGCGGATTTTGCGGCCGCTATGGTTAGGA
TGGGTGATATCCGTCCCCTTACCGGCCGCAATGGGGAGATTAGGAAGAATTGCAGGGTGCCTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTCTTCTATTCTCATCTCCTTTGCATTGCTTGCTTCTACCTTGTTCTTCATGAGTGGTCCCTCTTCAGCCCAACTCACTCCCAACTTCTACTCAAAAAGTTGCCCGAAGGTTTTTG
ATGTTGTCGGCTCAGTGGTTAGGGCCGCTGTAGCCAAGGAGAAACGCATGGGTGCATCTCTCCTTAGGCTCCATTTCCACGATTGTTTTGTAAAT
GGGTGTGACGGGTCCATTCTACTAG
ATGACACATCTTCGTTCACTGGAGAAAAGACTGCCAGGCCGAATGTGAATTCGGTTAGGGGTTTTAATGTGATTGATGATGTAAAGAAGAAGGTTGAAGGAGTTTGTCCCGGTGTTGTCT
CTTGTGCTGATATACTGGCGATTTCTGCTCTTGAATCCATGCTTGCT
TTAGGTGGGCCTGAATGGACAGTCAAGTTAGGAAGAAGAGACTCCAAAACAGCCAGCTTCTCCGCGGCAAACA
GCGGCGTTATTCCGCCACCAACATCCACCCTCAGCAACCTCATCAACCGCTTCCAAGCCGTCGGTCTATCCACTAGAGACATGGTGGCACTCTCGGGTGCACACACAATCGGACAAGCAC
GATGCACCACATTTAGAGCACGTATTTACAACGACACCAACATTGATGCCGCATTCGCCAGATCACGCAGATCAAACTGCCCTCGTCCATCCGGCTCAGGCGACAACAACCTTGCACCAC
TTGACGTTAAAACGCCCAACAGTTTCGATAACGCTTATTATGGGAATTTAATTAGCCAAAAGGGTTTGCTTCGGTCGGACCAGCAGTTGCACAATGGTGGCTCCACCGATTCGTTGGTGG
AGCAGTACAACAAAAATCCGCGTAGTTTCTATGCGGATTTTGCGGCCGCTATGGTTAGGATGGGTGATATCCGTCCCCTTACCGGCCGCAATGGGGAGATTAGGAAGAATTGCAGGGTGC
CTAATTAG

Retrieve as FASTA