Entry information : SmPrx01-1_122 (SmPrx01a_122)
Entry ID 2209
Creation 2009-08-18 (Christophe Dunand)
Last sequence changes 2009-08-18 (Christophe Dunand)
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx01-1_122 (SmPrx01a_122)
Name (synonym) SmPrx01-1_122 (SmPrx01a_122)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx01-1_122
start..stop
S start..stop
SmPrx01-2_114 684 0 1..341 1..341
SmPrx09-2_89 452 1e-160 19..323 28..331
SmPrx09-1_40 452 1e-160 19..323 28..331
SmPrx02-1_122 333 4e-114 5..325 8..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 121258..121455 198 N° 2 121006..121200 195 N° 3 120774..120939 166 N° 4 120240..120706 467
complement(join(120240..120706,120774..120939,121006..121200,121258..121455))


exon

Literature and cross-references SmPrx01-1_122 (SmPrx01a_122)
Literature DOE Joint Genome Institute and Stanford Human Genome Center, unpublished
DNA ref. Phytozome 12:   scaffold_122 (121455..120240)
mRNA ref. JGI transcript:   236348
EST ref. GenBank:   FE452989.1 [5' end]   FE452988.1 [3' end]
Protein sequence: SmPrx01-1_122 (SmPrx01a_122)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341 (320)
PWM (Da):   %s   37443.92 (35156.7)  
PI (pH):   %s   7.93 (7.31) Peptide Signal:   %s   cut: 22 range:22-341
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKRMLVVSMLAILCLADARTEEFFYNRTCPNAETIVRDVVTSHFRNNRTIPAALLRLFFHDCFVEGCDGSLLLDASADGAVIEKQALPNNNSARGFEVIDDAKARLESTCPGVVSCADILALAARDSVVLTGAPFFVMPTGRFDGRISNRTLAEAALPSPFDSATRLKDSFARQNLTVQDLVHLSGAHTIGQSQCQFFSPRLYNFSNTGVPDPTLNATYRAELQQACPRNANATNRVALDRGSEFVVDNSYYRNLVAGRGLLRSDQELTLDSETESIVRSFAGDENRFQLRFRRSLLKMGELRIKTSANGEIRRNCRRVNPRNTIIVTTTNGDDAAASTI

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 2 ESTs. In the same clone than SmPrx02b and SmPrx03b. strain="Plant Delights"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAAAGAATGCTTGTGGTGTCGATGCTTGCAATCCTATGTCTTGCAGATGCGCGCACCGAGGAGTTCTTCTACAACAGGACTTGCCCGAATGCGGAGACGATTGTCCGAGACGTG
GTCACCTCGCATTTCCGGAACAACCGGACCATCCCGGCGGCACTGCTGCGACTCTTTTTCCACGACTGCTTCGTCGAG
GTATACAAGCTCTAGGTGGTCAGCTCGACTCGCTAGGATTGA
TTTGGAAATTGGCAGGGGTGTGATGGATCGCTGCTGCTGGATGCGTCCGCCGATGGCGCTGTGATCGAGAAGCAGGCGCTGCCAAACAACAACTCGGCCCGGGGCTTCGAGGTGATTGAC
GATGCAAAGGCGCGGCTCGAGAGCACTTGCCCCGGCGTCGTCTCGTGCGCGGACATCCTCGCGCTGGCAGCAAGAGACTCGGTTGTCCTC
GTAAGTTTGGTTTGATCCTTGATGGCGATA
TCAGTTATCTCACTATGATCACTCTTGTTTCTCTAGACCGGAGCACCCTTCTTTGTCATGCCCACCGGCCGCTTTGATGGTCGGATCTCAAACCGGACACTCGCCGAGGCCGCTCTGCCA
TCGCCATTCGACAGTGCCACCAGGCTCAAGGACTCATTCGCTCGACAGAACCTCACAGTCCAGGACTTGGTCCACCTCTCGG
GTACGTAAAACTATTATATCGTCACTATTACGTAGTGA
TATAGCCAACCGGACTCCAACTTCCACAGGGGCACACACAATTGGCCAGTCGCAATGTCAGTTCTTCTCGCCCCGCCTCTACAACTTTAGCAACACTGGAGTCCCGGATCCAACCTTGAA
TGCCACGTACCGGGCCGAGCTCCAGCAGGCATGCCCGCGCAACGCCAATGCCACCAACAGGGTGGCGCTGGACCGAGGCTCCGAGTTCGTGGTGGACAACAGCTACTATCGCAACCTGGT
GGCGGGGAGGGGGCTGCTGCGATCCGACCAGGAGCTCACCCTTGACTCGGAGACGGAGAGCATCGTGCGGTCGTTTGCCGGGGACGAGAACCGATTCCAGCTGCGCTTCCGGAGGTCTCT
GCTCAAGATGGGCGAGCTGAGGATCAAGACGTCGGCCAACGGGGAGATTCGGAGGAACTGTAGGCGCGTGAACCCTAGAAACACCATCATTGTCACCACCACGAATGGCGATGATGCCGC
TGCCTCCACCATCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAAAGAATGCTTGTGGTGTCGATGCTTGCAATCCTATGTCTTGCAGATGCGCGCACCGAGGAGTTCTTCTACAACAGGACTTGCCCGAATGCGGAGACGATTGTCCGAGACGTG
GTCACCTCGCATTTCCGGAACAACCGGACCATCCCGGCGGCACTGCTGCGACTCTTTTTCCACGACTGCTTCGTCGAG
GGGTGTGATGGATCGCTGCTGCTGGATGCGTCCGCCGATGGC
GCTGTGATCGAGAAGCAGGCGCTGCCAAACAACAACTCGGCCCGGGGCTTCGAGGTGATTGACGATGCAAAGGCGCGGCTCGAGAGCACTTGCCCCGGCGTCGTCTCGTGCGCGGACATC
CTCGCGCTGGCAGCAAGAGACTCGGTTGTCCTC
ACCGGAGCACCCTTCTTTGTCATGCCCACCGGCCGCTTTGATGGTCGGATCTCAAACCGGACACTCGCCGAGGCCGCTCTGCCATCG
CCATTCGACAGTGCCACCAGGCTCAAGGACTCATTCGCTCGACAGAACCTCACAGTCCAGGACTTGGTCCACCTCTCGG
GGGCACACACAATTGGCCAGTCGCAATGTCAGTTCTTCTCG
CCCCGCCTCTACAACTTTAGCAACACTGGAGTCCCGGATCCAACCTTGAATGCCACGTACCGGGCCGAGCTCCAGCAGGCATGCCCGCGCAACGCCAATGCCACCAACAGGGTGGCGCTG
GACCGAGGCTCCGAGTTCGTGGTGGACAACAGCTACTATCGCAACCTGGTGGCGGGGAGGGGGCTGCTGCGATCCGACCAGGAGCTCACCCTTGACTCGGAGACGGAGAGCATCGTGCGG
TCGTTTGCCGGGGACGAGAACCGATTCCAGCTGCGCTTCCGGAGGTCTCTGCTCAAGATGGGCGAGCTGAGGATCAAGACGTCGGCCAACGGGGAGATTCGGAGGAACTGTAGGCGCGTG
AACCCTAGAAACACCATCATTGTCACCACCACGAATGGCGATGATGCCGCTGCCTCCACCATCTAG

Retrieve as FASTA