Entry information : SmPrx02-1_122 (SmPrx02a_122)
Entry ID 2210
Creation 2006-05-24 (Christophe Dunand)
Last sequence changes 2006-05-24 (Christophe Dunand)
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx02-1_122 (SmPrx02a_122)
Name (synonym) SmPrx02-1_122 (SmPrx02a_122)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx02-1_122
start..stop
S start..stop
SmPrx02-2_114 707 0 1..354 1..354
SmPrx22-1_79 366 6e-127 6..327 20..340
SmPrx22-2_67 362 2e-125 29..327 40..337
SmPrx01-1_122 333 4e-114 8..331 5..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 118854..119066 213 N° 2 119120..119314 195 N° 3 119386..119551 166 N° 4 119605..120095 491
join(118854..119066,119120..119314,119386..119551,119605..120095)


exon

Literature and cross-references SmPrx02-1_122 (SmPrx02a_122)
Literature DOE Joint Genome Institute and Stanford Human Genome Center, unpublished
DNA ref. Phytozome 12:   scaffold_122 (118854..120095)
mRNA ref. JGI transcript:   24753 [Fragment]
Protein sequence: SmPrx02-1_122 (SmPrx02a_122)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   354 (330)
PWM (Da):   %s   37814.47 (35245.1)  
PI (pH):   %s   8.74 (8.92) Peptide Signal:   %s   cut: 25 range:25-354
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPWFSAAMIVVILTAILELGVVQSSTVVGYYSHSCPAAEKIVSQVVAEQFATRPLVAAGILRLYFHDCFVEGCDGSILLDASPDGTPPEKRSLANNNTATGFELVDAAKRRIEAVCPGTVSCADILALAARDSVAISGGPRWEEPTGRYDGRVSLASNADGSIPGPSFNLTRLIQSFANKTLDSRDLVTLSGGHTIGRSHCANFQIRLYNFSGTGLPDPALNPAYAAALRRICPNTSPARRATLSLDRGSEIPFDNSYFVQLLAGNGLLRSDEELLLDGSMRGLISAFAANQRLFFREFAKAMVKLGGIGVKDSIQGEIRLHCRRVNRRNSGSSPRVPTPPAPIMRSRAPPPPY

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST. The contig also contains SmPrx01 and 03.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTGGTTCTCGGCAGCGATGATAGTTGTGATACTGACAGCAATTTTGGAGCTTGGAGTGGTCCAGAGCAGCACCGTGGTGGGATACTACTCACACTCTTGCCCGGCGGCCGAGAAG
ATTGTGAGCCAGGTTGTGGCGGAGCAATTCGCAACCAGGCCGCTCGTCGCTGCCGGTATACTTCGACTCTACTTCCACGACTGCTTCGTAGAG
GTAGCGCGCGAAAGTGGTAAAATCCTG
TTCTTACATTTCTGTGTGTATCAAAGGGATGCGATGGATCCATTCTTCTCGACGCATCGCCCGACGGCACACCGCCTGAGAAGCGGAGCCTGGCAAACAATAACACAGCCACTGGATTCG
AGCTCGTCGACGCGGCCAAGAGACGCATCGAGGCGGTCTGTCCGGGTACCGTATCGTGCGCTGACATTCTCGCTCTGGCCGCCAGAGACTCCGTCGCAATA
GTAAGTGCCTGGATCATCA
TGGTCGAATAAGCTCTTCACAGGTTCTTGATGATTGTTGCTCGGTGATATAGTCGGGGGGACCTCGCTGGGAGGAGCCAACTGGACGCTACGATGGAAGGGTGTCTCTGGCGTCCAATGC
TGATGGCAGCATTCCTGGGCCTTCCTTCAACCTCACTCGCCTCATCCAATCCTTCGCAAACAAGACACTCGATTCCAGGGACCTTGTCACACTCTCGG
GTACGATCAGATGCATGAAGAT
AACATAACCCATGTCGAAACAATCAATGCAGGAGGCCACACGATCGGTCGATCCCATTGCGCCAACTTCCAAATCCGTCTCTACAATTTCTCTGGAACCGGGCTACCGGACCCGGCGTTG
AATCCCGCCTACGCCGCTGCTTTGAGACGGATCTGCCCAAACACTTCTCCGGCCAGGCGCGCGACACTGTCTCTAGACAGAGGCAGCGAGATCCCCTTCGACAACTCGTACTTTGTGCAG
CTCCTGGCTGGCAACGGGCTTCTCAGGAGCGACGAGGAGCTGCTGCTGGATGGATCCATGCGGGGCCTCATCAGTGCTTTCGCCGCAAACCAGCGACTCTTTTTCCGCGAGTTTGCCAAG
GCTATGGTGAAGTTGGGAGGGATTGGTGTCAAGGATTCCATCCAGGGCGAGATCAGGCTGCATTGCCGGCGCGTGAATAGAAGAAACTCTGGATCATCCCCGCGAGTTCCCACGCCACCA
GCTCCAATAATGCGCTCCAGAGCTCCGCCACCTCCGTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTGGTTCTCGGCAGCGATGATAGTTGTGATACTGACAGCAATTTTGGAGCTTGGAGTGGTCCAGAGCAGCACCGTGGTGGGATACTACTCACACTCTTGCCCGGCGGCCGAGAAG
ATTGTGAGCCAGGTTGTGGCGGAGCAATTCGCAACCAGGCCGCTCGTCGCTGCCGGTATACTTCGACTCTACTTCCACGACTGCTTCGTAGAG
GGATGCGATGGATCCATTCTTCTCGAC
GCATCGCCCGACGGCACACCGCCTGAGAAGCGGAGCCTGGCAAACAATAACACAGCCACTGGATTCGAGCTCGTCGACGCGGCCAAGAGACGCATCGAGGCGGTCTGTCCGGGTACCGTA
TCGTGCGCTGACATTCTCGCTCTGGCCGCCAGAGACTCCGTCGCAATA
TCGGGGGGACCTCGCTGGGAGGAGCCAACTGGACGCTACGATGGAAGGGTGTCTCTGGCGTCCAATGCTGAT
GGCAGCATTCCTGGGCCTTCCTTCAACCTCACTCGCCTCATCCAATCCTTCGCAAACAAGACACTCGATTCCAGGGACCTTGTCACACTCTCGG
GAGGCCACACGATCGGTCGATCCCAT
TGCGCCAACTTCCAAATCCGTCTCTACAATTTCTCTGGAACCGGGCTACCGGACCCGGCGTTGAATCCCGCCTACGCCGCTGCTTTGAGACGGATCTGCCCAAACACTTCTCCGGCCAGG
CGCGCGACACTGTCTCTAGACAGAGGCAGCGAGATCCCCTTCGACAACTCGTACTTTGTGCAGCTCCTGGCTGGCAACGGGCTTCTCAGGAGCGACGAGGAGCTGCTGCTGGATGGATCC
ATGCGGGGCCTCATCAGTGCTTTCGCCGCAAACCAGCGACTCTTTTTCCGCGAGTTTGCCAAGGCTATGGTGAAGTTGGGAGGGATTGGTGTCAAGGATTCCATCCAGGGCGAGATCAGG
CTGCATTGCCGGCGCGTGAATAGAAGAAACTCTGGATCATCCCCGCGAGTTCCCACGCCACCAGCTCCAATAATGCGCTCCAGAGCTCCGCCACCTCCGTACTAG

Retrieve as FASTA