Entry information : SsqPrx01_OS-Bill4 (SSP1)
Entry ID 2318
Creation 2006-08-25 (Christophe Dunand)
Last sequence changes 2015-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-12-07 (Achraf Jemmat)
Peroxidase information: SsqPrx01_OS-Bill4 (SSP1)
Name (synonym) SsqPrx01_OS-Bill4 (SSP1)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Senecio
Organism Senecio squalidus    [TaxId: 121554 ]
Cellular localisation N/D
Tissue type Flowers
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsqPrx01_OS-Bill4
start..stop
S start..stop
SsqPrx01_Ox15 675 0 1..326 1..326
SsqPrx01_Ox8 669 0 1..326 1..326
SsqPrx01_A34-4-23 662 0 1..326 1..326
SsqPrx01_Ox10 661 0 1..326 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 23..421 399 N° 2 517..679 163 N° 3 763..1176 414  
join(23..421,517..679,763..1176)


exon

Literature and cross-references SsqPrx01_OS-Bill4 (SSP1)
Literature McInnis,S.M., Costa,L., Guttierez-Marcos,J. and Hiscock,S.J. Isolation and characterization of a polymorphic stigma-specific class III peroxidase gene from Senecio squalidus L. (Asteraceae)
PMB 2005
Protein ref. UniProtKB:   Q4A3Z3
DNA ref. GenBank:   AJ810532.1 (23..1176)
mRNA ref. GenBank:   AJ810530.1
Protein sequence: SsqPrx01_OS-Bill4 (SSP1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (299)
PWM (Da):   %s   35711.32 (32755.7) Transmb domain:   %s   i12-34o
PI (pH):   %s   7.75 (7.74) Peptide Signal:   %s   cut: 28 range:28-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEVYSHIRTPIILFVVIFAALTSLALGCKVGFYQATCPRAESIVQSVVKSAIRSNPTYAPGILRLFFHDCFVNGCDASVLLDGSTSEQTASTNSHLRGFEVISTAKARVETECPGVVSCADILALAARDSVVETGLPRWEVPTGRRDGLVSRAEDALKLPGSRDSAEVQIEKFAAKGLNIEELVTLVGGHTIGTSACARFVHRLYNYSNTNAPDPHIDQAFLPHLQTLCPEHGDRTIRVDLDTGSVNNFDTSYYENLRKGRGVLESDTKLWTHHITQNLVQQFISVGRPNQLTFSKKFARAMVKLSQVEVKTGNEGEIRRVCNRIN

Retrieve as FASTA  
Remarks Complete sequence from mRNA and genomic (introns 2 and 3). Isolate="OS-Bill4".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGTTTATTCCCATATAAGAACACCCATAATCTTGTTTGTTGTCATTTTCGCCGCCTTGACCAGCTTGGCACTAGGTTGCAAAGTTGGGTTCTATCAGGCCACATGCCCGAGAGCG
GAATCCATTGTGCAGTCTGTGGTTAAGTCTGCCATCCGGTCTAACCCGACATATGCACCTGGTATACTAAGACTGTTTTTTCATGATTGTTTTGTTAATGGTTGTGATGCATCTGTTTTA
CTTGATGGTTCTACTTCTGAGCAAACCGCTTCAACGAATTCTCATTTGAGAGGCTTTGAAGTCATCAGTACTGCAAAGGCTAGGGTCGAAACTGAATGTCCTGGAGTTGTATCTTGTGCG
GACATTCTTGCCCTCGCTGCTCGTGATTCTGTCGTCGAG
GTAATTGTTGTTTGTTTGTAAAACATGCAATAAAGAGTTATAACTGTTTAAACAAGTAACATTTTGATTTTTCAAACATAT
GCGTGCCAGACTGGGTTGCCTAGATGGGAAGTTCCAACAGGACGGAGAGATGGATTAGTTTCACGGGCCGAAGATGCTCTAAAATTGCCTGGTTCAAGGGATTCTGCTGAAGTCCAAATC
GAGAAGTTTGCAGCCAAAGGTCTTAATATCGAAGAACTTGTTACCCTTGTTGGTAAG
TTAACTATGCACAAAGAATGGAACTTACTACTAACAAAGAAATTAACATGTGTGTATCTCGGT
TTAATGGTTTATCAGGAGGACACACTATCGGGACATCCGCTTGTGCAAGATTCGTCCACAGGCTATATAACTATAGCAACACCAATGCACCGGATCCACATATTGACCAAGCATTCCTTC
CCCACCTACAAACCTTATGCCCAGAACATGGTGATAGAACAATCCGTGTGGACTTAGATACAGGTAGCGTAAACAATTTCGACACATCATACTATGAAAACTTGAGGAAGGGACGAGGAG
TACTTGAATCGGATACAAAGCTATGGACACACCATATCACACAAAACTTAGTGCAACAATTTATTTCTGTTGGGAGACCAAATCAGTTGACATTCTCCAAAAAGTTTGCGAGAGCAATGG
TGAAGTTAAGTCAAGTTGAGGTAAAGACCGGTAATGAAGGAGAAATTCGTAGGGTTTGTAACAGAATTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGTTTATTCCCATATAAGAACACCCATAATCTTGTTTGTTGTCATTTTCGCCGCCTTGACCAGCTTGGCACTAGGTTGCAAAGTTGGGTTCTATCAGGCCACATGCCCGAGAGCG
GAATCCATTGTGCAGTCTGTGGTTAAGTCTGCCATCCGGTCTAACCCGACATATGCACCTGGTATACTAAGACTGTTTTTTCATGATTGTTTTGTTAATGGTTGTGATGCATCTGTTTTA
CTTGATGGTTCTACTTCTGAGCAAACCGCTTCAACGAATTCTCATTTGAGAGGCTTTGAAGTCATCAGTACTGCAAAGGCTAGGGTCGAAACTGAATGTCCTGGAGTTGTATCTTGTGCG
GACATTCTTGCCCTCGCTGCTCGTGATTCTGTCGTCGAG
GTTGCCTAGATGGGAAGTTCCAACAGGACGGAGAGATGGATTAGTTTCACGGGCCGAAGATGCTCTAAAATTGCCTGGTTC
AAGGGATTCTGCTGAAGTCCAAATCGAGAAGTTTGCAGCCAAAGGTCTTAATATCGAAGAACTTGTTACCCTTGTTGGTAAG
CACACTATCGGGACATCCGCTTGTGCAAGATTCGTCCA
CAGGCTATATAACTATAGCAACACCAATGCACCGGATCCACATATTGACCAAGCATTCCTTCCCCACCTACAAACCTTATGCCCAGAACATGGTGATAGAACAATCCGTGTGGACTTAGA
TACAGGTAGCGTAAACAATTTCGACACATCATACTATGAAAACTTGAGGAAGGGACGAGGAGTACTTGAATCGGATACAAAGCTATGGACACACCATATCACACAAAACTTAGTGCAACA
ATTTATTTCTGTTGGGAGACCAAATCAGTTGACATTCTCCAAAAAGTTTGCGAGAGCAATGGTGAAGTTAAGTCAAGTTGAGGTAAAGACCGGTAATGAAGGAGAAATTCGTAGGGTTTG
TAACAGAATTAATTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAAACCACGC ACAAATCATT ATAGCAATGG AGGTTTATTC CCATATAAGA ACACCCATAA TCTTGTTTGT TGTCATTTTC GCCGCCTTGA CCAGCTTGGC ACTAGGTTGC AAAGTTGGGT  TCTATCAGGC CACATGCCCG AGAGCGGAAT CCATTGTGCA GTCTGTGGTT AAGTCTGCCA TCCGGTCTAA CCCGACATAT GCACCTGGTA TACTAAGACT GTTTTTTCAT GATTGTTTTG  TTAATGGTTG TGATGCATCT GTTTTACTTG ATGGTTCTAC TTCTGAGCAA ACCGCTTCAA CGAATTCTCA TTTGAGAGGC TTTGAAGTCA TCAGTACTGC AAAGGCTAGG GTCGAAACTG  AATGTCCTGG AGTTGTATCT TGTGCGGACA TTCTTGCCCT CGCTGCTCGT GATTCTGTCG TCGAGACTGG GTTGCCTAGA TGGGAAGTTC CAACAGGACG GAGAGATGGA TTAGTTTCAC  GGGCCGAAGA TGCTCTAAAA TTGCCTGGTT CAAGGGATTC TGCTGAAGTC CAAATCGAGA AGTTTGCAGC CAAAGGTCTT AATATCGAAG AACTTGTTAC CCTTGTTGGA GGACACACTA  TCGGGACATC CGCTTGTGCA AGATTCGTCC ACAGGCTATA TAACTATAGC AACACCAATG CACCGGATCC ACATATTGAC CAAGCATTCC TTCCCCACCT ACAAACCTTA TGCCCAGAAC  ATGGTGATAG AACAATCCGT GTGGACTTAG ATACAGGTAG CGTAAACAAT TTCGACACAT CATACTATGA AAACTTGAGG AAGGGACGAG GAGTACTTGA ATCGGATACA AAGCTATGGA  CACACCATAT CACACAAAAC TTAGTGCAAC AATTTATTTC TGTTGGGAGA CCAAATCAGT TGACATTCTC CAAAAAGTTT GCGAGAGCAA TGGTGAAGTT AAGTCAAGTT GAGGTAAAGA  CCGGTAATGA AGGAGAAATT CGTAGGGTTT GTAACAGAAT TAATTAAGCA ACGATAATGG ATGCGCTGAT TAAATAAACT CATTCGAACA TGAAGAAACG AGTGTCATAG TTATGTAATC 
ATGCTCATAA TAATACCCGA GAAGATTAGG ATGAAATTTG AGAACAATTA AGCCCTTGAG CCAAAATAAT GAATACCAGT TTACCGCC 

Retrieve as FASTA