Entry information : AbVP02_bisporus
Entry ID 2402
Creation 2006-07-05 (Christophe Dunand)
Last sequence changes 2011-10-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information: AbVP02_bisporus
Name AbVP02_bisporus
Class Versatile peroxidase    [Orthogroup: VP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbVP02_bisporus
start..stop
S start..stop
AbVP01_bisporus 488 9e-175 1..353 1..354
PoVP04_PC15 458 8e-163 1..351 1..354
PoVP04_PC9 454 3e-161 1..332 1..333
PoVP06_PC9 436 6e-154 1..332 1..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 756670..756730 61 N° 2 756492..756616 125 N° 3 756376..756434 59 N° 4 756189..756323 135
N° 5 756017..756138 122 N° 6 755884..755959 76 N° 7 755798..755834 37 N° 8 755735..755742 8
N° 9 755601..755681 81 N° 10 755485..755554 70 N° 11 755417..755426 10 N° 12 755325..755360 36
N° 13 755100..755272 173 N° 14 754980..755038 59 N° 15 754910..754922 13  
complement(join(754910..754922,754980..755038,755100..755272,755325..755360,7554 17..755426,755485..755554,755601..755681,755735..755742,755798..755834,755884..7 55959,756017..756138,756189..756323,756376..756434,756492..756616,756670..756730 ))


exon

Literature and cross-references AbVP02_bisporus
Literature Lankinen,P., Hilden,K., Aro,N., Salkinoja-Salonen,M. and Hatakka,A. Manganese peroxidase of Agaricus bisporus: grain bran-promoted production and gene characterization Appl. Microbiol. Biotechnol. 66 (4), 401-407 (2005)
Protein ref. UniProtKB:   Q5TJC2
DNA ref. JGI genome:   scaffold_5 (756730..754910)
mRNA ref. GenBank:   AJ699058.1
Protein sequence: AbVP02_bisporus
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   354 (333)
PWM (Da):   %s   37525.52 (35284.2)  
PI (pH):   %s   3.95 (3.91) Peptide Signal:   %s   cut: 22 range:22-354
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKILLSLILALNAVQFIAAVPTRRAQCADGTTVSNEACCVLLPIIADIQPNLFENECGEVHETLRASFHDAIGFSRAAGGGGADGSLVTFGDVETTFAANAGIDEIVETLRPFINSHNISAGDFIQFATVVGLTNCPGAPRIPFFLGRPDATAASPDGLVPEPDSVTKILERFDDAGFTPTEVVALLASHTVAASDTIEPLEGVPFDSTPGEFDRQFFIETMLKGTSFPGTGGNQGEALSPLPGELRLESDGLARDERTACDWQLFATDQQKMASAFSDAMVKLSLVGQDKSQLIDCSDVIPRTIPLTNEPYFPADLTKDDLEQCPDEFPDYPSNPSVTSVAPVPTS

Retrieve as FASTA  
Remarks Complete sequence from genomic (14 introns). Strain="ATCC 62459".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAAATTCTTCTCAGCCTTATTTTGGCTTTGAACGCCGTCCAATTTATTGCTGGTACGCACTTTACTCATATCCTCATATTATTTGCCGACAAGTCAACGATGTAGCTGTTC
CTACCAGGAGGGCCCAATGTGCCGATGGCACCACTGTTTCTAATGAGGCCTGTTGCGTTCTGCTCCCCATTATAGCAGATATCCAGCCGAACTTGTTCGAAAACGAGTGCGGTGAAGAG
G
TAATGATTTAATTTTTTGATAGAGTTACGATATTCAACAGCATATTTATACTTTAGGTCCATGAAACCTTGCGGGCATCATTTCATGATGCTATCGGATTCTCCAGAGCAGCTGGGTAGG
TTCTGACTGTCTGTGGCGGCAGCTAGTATCGCTAAAATGATTTCCAGTGGTGGTGGTGCTGATGGTTCTCTCGTCACTTTCGGCGATGTGGAGACCACATTTGCCGCTAACGCAGGAATC
GACGAGATTGTAGAGACATTACGACCTTTTATAAACAGCCACAACATCAGTGCCGGCGATTT
GTGAGCCTGGACTCATAATCTGTGTTGCATCCTGTTAACGCTCTTCCTAGCATCCAGT
TTGCAACCGTTGTTGGATTGACCAACTGCCCCGGCGCACCTCGCATACCCTTTTTCTTAGGCCGCCCAGACGCTACCGCCGCTTCCCCCGATGGTCTTGTCCCTGAGCCCTTCG
GTCAGT
CTCTCATCAGCCTTTCCGGTATAATCTACAACCCAAGTTGATAATCAACAGATTCCGTCACGAAAATTCTTGAACGCTTCGATGATGCTGGTTTTACCCCCACTGAAGTTGTTGCATTGC
TTGCATC
GTGAGTCTCTAGAACAAGATCGAGAAATATGTGTCCAATCCCCCCGTAGTCATACTGTCGCAGCTTCGGACACAATTGAGCCCGGTGTAAGTTTATTTCTTCGTCAGTATGCA
TTCTCATCTCATGAGCACCTTATTCCAGCTCGAAGGGTAAGACATTCCCTATCAATAAGAAACGTCTCAGTATCCAACGCAACCTCTAGTGTCCCCTTCGACTCGACTCCCGGAGAATTT
GACAGGCAGTTCTTTATCGAGACTATGCTTAAAGGCACTTCCTTCCCAGG
GTAAGTAGTTCGTTGACATTCGTTACGCATCCTAATTTTGGCAAAGCACTGGGGGGAACCAAGGTGAAGC
CTTATCTCCCTTGCCGGGAGAACTTCGTCTCGAATCCGATGGACTT
GTACGTATACAGTCTTTTGTTGTCTGAATTTGTGATTGTTAACATTATTTATCATTAGTTGGCTCGAGGTCTGT
CTTGCTAACAAAAGGCATCTGATAACATTGAAGGACTAACTTGATCATAGATGAACGAACCGCATGTGACTGGCAACTCTTCGCTAGTAAGAATGTTTGCCAACCAAGAAGAATAGCTCA
CCTAAAATTCCACGATAGCTGATCAACAAAAAATGGCATCGGCATTTAGCGACGCCATGGTCAAACTGTCTCTCGTCGGGCAAGATAAGAGCCAATTGATTGATTGTTCAGACGTCATTC
CGCGAACGATCCCTTTGACAAATGAACCATACTTCCCTGCCGACTTGACCAAAGATGATCTTGAGCAGACC
GTGAGTCCAATTGACATTCACAATACGATTTCCACTCTGAGCCTGCTTG
TTTTTGATACAGTGCCCGGATGAATTCCCTGATTACCCTTCCAACCCCAGTGTCACTTCGGTCGCGCCAGTGTAAGTTTATGATCAGCTCCAGACGTCTGCTCTTATTCACTCTGCGCAA
ATATCTAGTCCCACCTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAAATTCTTCTCAGCCTTATTTTGGCTTTGAACGCCGTCCAATTTATTGCTGCTGTTCCTACCAGGAGGGCCCAATGTGCCGATGGCACCACTGTTTCTAATGAGGCCTGT
TGCGTTCTGCTCCCCATTATAGCAGATATCCAGCCGAACTTGTTCGAAAACGAGTGCGGTGAAGAG
GTCCATGAAACCTTGCGGGCATCATTTCATGATGCTATCGGATTCTCCAGAGCA
GCTGG
TGGTGGTGGTGCTGATGGTTCTCTCGTCACTTTCGGCGATGTGGAGACCACATTTGCCGCTAACGCAGGAATCGACGAGATTGTAGAGACATTACGACCTTTTATAAACAGCCAC
AACATCAGTGCCGGCGATTT
CATCCAGTTTGCAACCGTTGTTGGATTGACCAACTGCCCCGGCGCACCTCGCATACCCTTTTTCTTAGGCCGCCCAGACGCTACCGCCGCTTCCCCCGAT
GGTCTTGTCCCTGAGCCCTTCG
ATTCCGTCACGAAAATTCTTGAACGCTTCGATGATGCTGGTTTTACCCCCACTGAAGTTGTTGCATTGCTTGCATCTCATACTGTCGCAGCTTCGGAC
ACAATTGAGCCCGGT
CTCGAAGGTGTCCCCTTCGACTCGACTCCCGGAGAATTTGACAGGCAGTTCTTTATCGAGACTATGCTTAAAGGCACTTCCTTCCCAGGCACTGGGGGGAACCAA
GGTGAAGCCTTATCTCCCTTGCCGGGAGAACTTCGTCTCGAATCCGATGGACTT
TTGGCTCGAGATGAACGAACCGCATGTGACTGGCAACTCTTCGCTACTGATCAACAAAAAATGGCA
TCGGCATTTAGCGACGCCATGGTCAAACTGTCTCTCGTCGGGCAAGATAAGAGCCAATTGATTGATTGTTCAGACGTCATTCCGCGAACGATCCCTTTGACAAATGAACCATACTTCCCT
GCCGACTTGACCAAAGATGATCTTGAGCAGACC
TGCCCGGATGAATTCCCTGATTACCCTTCCAACCCCAGTGTCACTTCGGTCGCGCCAGTTCCCACCTCGTAA

Retrieve as FASTA