Entry information : PcLiP05_RP78 (LiP2 / GLG2 / PcLiPE_RP78)
Entry ID 2409
Creation 2006-09-01 (Christophe Dunand)
Last sequence changes 2011-09-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-11-24 (Christophe Dunand)
Peroxidase information: PcLiP05_RP78 (LiP2 / GLG2 / PcLiPE_RP78)
Name (synonym) PcLiP05_RP78 (LiP2 / GLG2 / PcLiPE_RP78)
Class Lignin peroxidase    [Orthogroup: LiP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcLiP05_RP78
start..stop
S start..stop
PcLiP05_BKMF1767 754 0 1..371 1..371
PcLiP02_RP78 677 0 1..368 1..368
PcLiP07_RF78 645 0 1..368 1..368
PcLiP08_RP78 644 0 1..368 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 360346..360406 61 N° 2 360134..360287 154 N° 3 360021..360077 57 N° 4 359750..359964 215
N° 5 359656..359697 42 N° 6 359529..359607 79 N° 7 359052..359475 424 N° 8 358935..358999 65
N° 9 358862..358880 19  
complement(join(358862..358880,358935..358999,359052..359475,359529..359607,3596 56..359697,359750..359964,360021..360077,360134..360287,360346..360406))


exon

Literature and cross-references PcLiP05_RP78 (LiP2 / GLG2 / PcLiPE_RP78)
Literature Ritch,T.G. Jr., Nipper,V.J., Akileswaran,L., Smith,A.J., Pribnow,D.G. and Gold,M.H. Lignin peroxidase from the basidiomycete Phanerochaete chrysosporium is synthesized as a preproenzyme Gene 107 (1), 119-126 (1991)
Protein ref. UniProtKB:   P49012
DNA ref. GenBank:   M92644 JGI genome:   scaffold_19 (360406..358861)
mRNA ref. GenBank:   M74229 JGI transcript:   11110
Protein sequence: PcLiP05_RP78 (LiP2 / GLG2 / PcLiPE_RP78)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   371 (350)
PWM (Da):   %s   39233.21 (37100.1)  
PI (pH):   %s   4.44 (4.39) Peptide Signal:   %s   cut: 22 range:22-371
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKQLFAAITVALSLTAANAAVVKEKRATCANGKTVGDASCCAWFDVLDDIQANMFHGGQCGAEAHESIRLVFHDSIAISPAMEAKGKFGGGGADGSIMIFDTIETAFHPNIGLDEVVAMQKPFVQKHGVTPGDFIAFAGAVALSNCPGAPQMNFFTGRKATQPAPDGLVPEPFHTVDQIIARVNDAGEFDELELVWMLSAHSVAAVNDVDPTVQGLPFDSTPGIFDSQFFVETQFRGTLFPGSGGNQGEVESGMAGEIRIQTDHTLARDSRTACEWQSFVGNQSKLVDDFQFIFLALTQLGQDPNAMTDCSDVIPLSKPIPGNGPFSFFPPGKSHSDIEQCAETPFPSLVTLPGPATSVARIPPHKA

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns) and mRNA. No EST. Strain="RP78" and "OGC101" (a derivative of ME446, but with different properties (Alic et al., Appl Environ Microbiol, 1987)).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCAGCTCTTCGCCGCGATCACCGTCGCCCTCTCGCTCACCGCTGCCAATGGTATGTACGGTTCCTTTCGCGTCAAGAACGCGTATTCTGACAGTCGGCTCTGCTGCAGC
GGCCGTGGTCAAGGAGAAGCGCGCCACCTGCGCCAACGGCAAGACCGTCGGCGACGCGTCCTGCTGCGCCTGGTTCGATGTCCTCGACGACATCCAGGCCAACATGTTCCACGGCGGCCA
GTGCGGCGCCGAGGCGCACGAGTCGATCCGTCT
GTAAGTTCCCGCATCCAAGTATCACTTCCTCCGTTCCGTGCTGAGCACCCATACAGCGTCTTCCACGACTCCATCGCCATCTCGCCC
GCCATGGAGGCCAAGGGCAAGTTCGG
GTAAGCAGTCTCGCGGTGCGCGCCCTTCTTGCAGCCGCTGAGCATTGTCTTTGCAGCGGCGGCGGTGCCGACGGCTCGATCATGATCTTCGATA
CTATCGAGACTGCATTCCACCCCAACATCGGTCTCGACGAGGTCGTCGCGATGCAGAAGCCGTTCGTCCAGAAGCACGGTGTCACTCCCGGAGACTTCATCGCCTTCGCCGGTGCTGTCG
CGCTCAGCAACTGCCCGGGTGCTCCGCAGATGAACTTCTTCACCGGCCGCAAGCCCG
GTAAGTGCAGGTGGACAACAGTCTTACAGCCCTCCTGACTTGTACGCTGCAGCTACCCAGCCT
GCTCCGGACGGTCTCGTCCCCGAGCCCTTCC
GTAAGTCGATCCTTAGTGCGGTAGTTACTTGAGCTGACCCCTGTCCAGACACCGTCGACCAGATCATCGCCCGCGTGAACGACGCCGGT
GAGTTCGATGAGCTCGAGCTCGTCTGGATGCTTTCTGC
GTGAGTGCTCGTTCTCGCTTAGCGCTACCGCTCCCGAGCTCACTGCACTGCAGCCACTCCGTTGCGGCCGTCAACGATGTGG
ACCCGACCGTCCAGGGCCTGCCCTTCGACTCCACCCCCGGAATCTTCGACTCGCAGTTCTTCGTCGAGACTCAGTTCCGTGGCACTCTCTTCCCCGGCTCCGGTGGCAACCAGGGTGAGG
TCGAGTCCGGCATGGCCGGCGAGATCCGCATTCAGACCGACCACACTCTCGCCCGTGACTCCCGCACCGCCTGCGAGTGGCAGTCCTTCGTCGGCAACCAGTCCAAGCTCGTCGATGACT
TCCAGTTCATCTTCCTCGCCCTCACTCAACTCGGCCAGGACCCAAACGCGATGACCGACTGCTCCGACGTCATCCCCCTCTCGAAGCCCATCCCCGGCAACGGCCCCTTCTCCTTCTTCC
CGCCCGGCAAGTCCCACAGCGACATCGAGCAGGCT
GTACGTGTTTGCTTTGAGTCACACGATGAGTTTGTCCTGACGATGCCTGCAGTGCGCCGAGACCCCCTTCCCCAGCCTCGTCACC
CTCCCCGGCCCCGCCACCTCGGTCGCTCGCAT
GTGAGTAGCTGTTATACCTTGCGGCATGCATTTCCTGACGAGCTCTCTCTGCAGCCCCCCGCACAAGGCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCAGCTCTTCGCCGCGATCACCGTCGCCCTCTCGCTCACCGCTGCCAATGCGGCCGTGGTCAAGGAGAAGCGCGCCACCTGCGCCAACGGCAAGACCGTCGGCGACGCG
TCCTGCTGCGCCTGGTTCGATGTCCTCGACGACATCCAGGCCAACATGTTCCACGGCGGCCAGTGCGGCGCCGAGGCGCACGAGTCGATCCGTCT
CGTCTTCCACGACTCCATCGCCATC
TCGCCCGCCATGGAGGCCAAGGGCAAGTTCGG
CGGCGGCGGTGCCGACGGCTCGATCATGATCTTCGATACTATCGAGACTGCATTCCACCCCAACATCGGTCTCGACGAGGTCGTCGCG
ATGCAGAAGCCGTTCGTCCAGAAGCACGGTGTCACTCCCGGAGACTTCATCGCCTTCGCCGGTGCTGTCGCGCTCAGCAACTGCCCGGGTGCTCCGCAGATGAACTTCTTCACCGGCCGC
AAGCCCG
CTACCCAGCCTGCTCCGGACGGTCTCGTCCCCGAGCCCTTCCACACCGTCGACCAGATCATCGCCCGCGTGAACGACGCCGGTGAGTTCGATGAGCTCGAGCTCGTCTGGATG
CTTTCTGC
CCACTCCGTTGCGGCCGTCAACGATGTGGACCCGACCGTCCAGGGCCTGCCCTTCGACTCCACCCCCGGAATCTTCGACTCGCAGTTCTTCGTCGAGACTCAGTTCCGTGGC
ACTCTCTTCCCCGGCTCCGGTGGCAACCAGGGTGAGGTCGAGTCCGGCATGGCCGGCGAGATCCGCATTCAGACCGACCACACTCTCGCCCGTGACTCCCGCACCGCCTGCGAGTGGCAG
TCCTTCGTCGGCAACCAGTCCAAGCTCGTCGATGACTTCCAGTTCATCTTCCTCGCCCTCACTCAACTCGGCCAGGACCCAAACGCGATGACCGACTGCTCCGACGTCATCCCCCTCTCG
AAGCCCATCCCCGGCAACGGCCCCTTCTCCTTCTTCCCGCCCGGCAAGTCCCACAGCGACATCGAGCAGGCT
TGCGCCGAGACCCCCTTCCCCAGCCTCGTCACCCTCCCCGGCCCCGCC
ACCTCGGTCGCTCGCAT
CCCCCCGCACAAGGCCTAA

Retrieve as FASTA