Entry information : PcLiP01_RP78 (LPOA / Ligninase H8 / PcLiPA_RP78)
Entry ID 2412
Creation 2006-12-28 (Christophe Dunand)
Last sequence changes 2012-03-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-29 (Christophe Dunand)
Peroxidase information: PcLiP01_RP78 (LPOA / Ligninase H8 / PcLiPA_RP78)
Name (synonym) PcLiP01_RP78 (LPOA / Ligninase H8 / PcLiPA_RP78)
Class Lignin peroxidase    [Orthogroup: LiP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcLiP01_RP78
start..stop
S start..stop
PcLiP08_BKMF1767 745 0 1..372 1..372
PcLiP01_SC26 702 0 28..372 1..345
PcLiP08_RP78 695 0 1..372 1..368
PcLiP07_RF78 673 0 1..372 1..372
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 373851..373911 61 N° 2 373972..374125 154 N° 3 374179..374235 57 N° 4 374290..374504 215
N° 5 374558..374599 42 N° 6 374653..374731 79 N° 7 374782..375205 424 N° 8 375260..375324 65
N° 9 375387..375408 22  
join(373851..373911,373972..374125,374179..374235,374290..374504,374558..374599, 374653..374731,374782..375205,375260..375324,375387..375408)


exon

Literature and cross-references PcLiP01_RP78 (LPOA / Ligninase H8 / PcLiPA_RP78)
Literature Walther,I., Kalin,M., Reiser,J., Suter,F., Fritsche,B., Saloheimo,M., Leisola,M., Teeri,T., Knowles,J.K. and Fiechter,A. Molecular analysis of a Phanerochaete chrysosporium lignin peroxidase gene. Gene 70 (1), 127-137 (1988)
Protein ref. UniProtKB:   P06181
DNA ref. GenBank:   M37701 JGI genome:   scaffold_19 (373851..375408)
mRNA ref. JGI transcript:   10957
Protein sequence: PcLiP01_RP78 (LPOA / Ligninase H8 / PcLiPA_RP78)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   372 (351)
PWM (Da):   %s   39504.44 (37359.2)  
PI (pH):   %s   4.23 (4.19) Peptide Signal:   %s   cut: 22 range:22-372
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKQLFAAISLALLLSAANAAAVIEKRATCSNGKTVGDASCCAWFDVLDDIQQNLFHGGQCGAEAHESIRLVFHDSIAISPAMEAQGKFGGGGADGSIMIFDDIETAFHPNIGLDEIVKLQKPFVQKHGVTPGDFIAFAGAVALSNCPGAPQMNFFTGRAATQPAPDGLVPEPFHTVDQIINRVNDAGEFDELELVWMLSAHSVAAVNDVDPTVQGLPFDSTPGIFDSQFFVETQLRGTAFPGSGGNQGEVESPLPGEIRIQSDHTIARDSRTACEWQSFVNNQSKLVDDFQFIFLALTQLGQDPNAMTDCSDVIPQSKPIPGNLPFSFFPAGKTIKDVEQCAETPFPTLTTLPGPETSVQRIPPPPGA

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns). Strain="BKM1767" and "RP78". Also referred to as peroxidase isozyme H8. Forms a cluster with LipB. Note that the accession Y00262 (the only SwissProt link to NCBI) gives a wrong sequence at the 3'end, that is why we prefer the accession AAA33740. Synonymous SwissProt accession: P31838 (named lpoB by the authors of the sequencing!!). Also note that depending on the NCBI accession (see SwissProt P06181/P38138), the sequence is not exactly the one entered here above, because of different sequencing groups.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCAGCTCTTCGCAGCTATCTCTCTCGCTCTCTTGCTCTCGGCTGCGAACGGTATGCCCATCGCAGTTAGCGTTGACCAGTGGACTGCATGCTGAACGTCGTCTTGTGCA
GCGGCTGCGGTGATCGAGAAGCGCGCCACCTGTTCCAACGGCAAGACCGTCGGCGATGCGTCGTGCTGCGCTTGGTTCGACGTCCTGGATGATATCCAGCAGAACCTGTTCCACGGCGGC
CAGTGCGGCGCTGAGGCGCACGAGTCGATTCGTCT
GTGAGTGATCCCGTCGCGATCTCCTGCTATGCATGTTTGAACACCCCGCCCAGCGTCTTCCACGACTCCATCGCAATTTCGCCCG
CCATGGAGGCACAGGGCAAGTTCGG
GTAAGTTGCCACCCGCGTTGCGCCACCTAGTCGTTTGCTGATCCCTCCTTGCAGCGGCGGTGGTGCTGACGGCTCCATCATGATCTTCGACGATA
TCGAGACTGCGTTCCACCCTAACATCGGTCTCGACGAGATCGTCAAGCTCCAGAAGCCATTCGTTCAGAAGCACGGTGTCACCCCTGGTGACTTCATCGCCTTCGCTGGTGCTGTCGCGC
TCAGCAACTGCCCTGGTGCCCCGCAGATGAACTTCTTCACTGGTCGTGCACCTG
GTATACCTGCAAAACTCGCTTTGCGGATGGTACGAACTAACTGTCTGCTTTAGCTACCCAGCCCGC
TCCTGATGGCCTTGTCCCCGAGCCCTTCC
GTAAGTGGTCTTATCCAAGCAGTTAGGTGCGGTCTATACTGACTAGCATGCAGACACTGTCGACCAAATCATCAACCGTGTCAACGACGCA
GGCGAGTTCGATGAGCTCGAGCTTGTCTGGATGCTCTCCGC
GTAAGTCACTCACTGTTGACTTCGACACTCCCTTCCTGAGACCTCGACAGGCACTCCGTCGCAGCGGTGAACGACGTCG
ACCCGACCGTCCAGGGTCTGCCCTTTGACTCGACCCCCGGAATCTTCGACTCCCAGTTCTTCGTCGAGACTCAGCTTCGTGGTACCGCCTTCCCCGGCTCTGGTGGCAACCAAGGCGAGG
TCGAGTCGCCGCTCCCTGGCGAAATTCGCATCCAGTCCGACCACACTATCGCCCGCGACTCGCGCACGGCGTGTGAATGGCAGTCCTTCGTCAACAACCAGTCCAAGCTCGTCGATGACT
TCCAGTTCATCTTCCTCGCCCTCACCCAGCTCGGCCAGGACCCGAACGCGATGACCGACTGCTCGGATGTTATCCCGCAGTCCAAGCCCATCCCTGGCAACCTCCCATTCTCGTTCTTCC
CCGCTGGCAAGACCATCAAGGACGTTGAGCAGGCG
GTGCGTATTTCACCCCACCATGCAGTAGAGTGGCTGCTGAACATCGCATGACAGTGTGCGGAGACCCCCTTCCCGACTCTCACCA
CTCTCCCGGGCCCCGAGACGTCCGTCCAGCGCAT
GTGAGTACAATCCATGAGATCTTTCAGGAAATGCAATCTGGGCTGACATGCTCCTTCTCCAGCCCTCCGCCTCCGGGTGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGCAGCTCTTCGCAGCTATCTCTCTCGCTCTCTTGCTCTCGGCTGCGAACGCGGCTGCGGTGATCGAGAAGCGCGCCACCTGTTCCAACGGCAAGACCGTCGGCGATGCG
TCGTGCTGCGCTTGGTTCGACGTCCTGGATGATATCCAGCAGAACCTGTTCCACGGCGGCCAGTGCGGCGCTGAGGCGCACGAGTCGATTCGTCT
CGTCTTCCACGACTCCATCGCAATT
TCGCCCGCCATGGAGGCACAGGGCAAGTTCGG
CGGCGGTGGTGCTGACGGCTCCATCATGATCTTCGACGATATCGAGACTGCGTTCCACCCTAACATCGGTCTCGACGAGATCGTCAAG
CTCCAGAAGCCATTCGTTCAGAAGCACGGTGTCACCCCTGGTGACTTCATCGCCTTCGCTGGTGCTGTCGCGCTCAGCAACTGCCCTGGTGCCCCGCAGATGAACTTCTTCACTGGTCGT
GCACCTG
CTACCCAGCCCGCTCCTGATGGCCTTGTCCCCGAGCCCTTCCACACTGTCGACCAAATCATCAACCGTGTCAACGACGCAGGCGAGTTCGATGAGCTCGAGCTTGTCTGGATG
CTCTCCGC
GCACTCCGTCGCAGCGGTGAACGACGTCGACCCGACCGTCCAGGGTCTGCCCTTTGACTCGACCCCCGGAATCTTCGACTCCCAGTTCTTCGTCGAGACTCAGCTTCGTGGT
ACCGCCTTCCCCGGCTCTGGTGGCAACCAAGGCGAGGTCGAGTCGCCGCTCCCTGGCGAAATTCGCATCCAGTCCGACCACACTATCGCCCGCGACTCGCGCACGGCGTGTGAATGGCAG
TCCTTCGTCAACAACCAGTCCAAGCTCGTCGATGACTTCCAGTTCATCTTCCTCGCCCTCACCCAGCTCGGCCAGGACCCGAACGCGATGACCGACTGCTCGGATGTTATCCCGCAGTCC
AAGCCCATCCCTGGCAACCTCCCATTCTCGTTCTTCCCCGCTGGCAAGACCATCAAGGACGTTGAGCAGGCG
TGTGCGGAGACCCCCTTCCCGACTCTCACCACTCTCCCGGGCCCCGAG
ACGTCCGTCCAGCGCAT
CCCTCCGCCTCCGGGTGCTTAA

Retrieve as FASTA