Entry information : PcLiP06 (GLG6 / PcLiPF)
Entry ID 2415
Creation 2006-08-30 (Christophe Dunand)
Last sequence changes 2012-03-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-29 (Christophe Dunand)
Peroxidase information: PcLiP06 (GLG6 / PcLiPF)
Name (synonym) PcLiP06 (GLG6 / PcLiPF)
Class Lignin peroxidase    [Orthogroup: LiP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcLiP06
start..stop
S start..stop
PcLiP06_RP78 748 0 1..372 1..372
PsoLiP07 664 0 1..372 1..373
PcLiP09_ME446 662 0 1..372 1..372
PcLiP09_RP78 658 0 1..372 1..372
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 318..378 61 N° 2 429..582 154 N° 3 633..689 57 N° 4 740..954 215
N° 5 1005..1046 42 N° 6 1098..1176 79 N° 7 1229..1470 242 N° 8 1528..1709 182
N° 9 1763..1827 65 N° 10 1888..1906 19  
join(318..378,429..582,633..689,740..954,1005..1046,1098..1176,1229..1470,1528.. 1709,1763..1827,1888..1906)


exon

Literature and cross-references PcLiP06 (GLG6 / PcLiPF)
Literature Naidu P.S., Zhang Y.Z., Reddy C.A. Characterization of a new lignin peroxidase gene (GLG6) from Phanerochaete chrysosporium. Biochem. Biophys. Res. Commun. 173:994-1000(1990).
Protein ref. UniProtKB:   P50622
DNA ref. GenBank:   M77508
mRNA ref. GenBank:   M80213
Protein sequence: PcLiP06 (GLG6 / PcLiPF)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   372
PWM (Da):   %s   39163.13  
PI (pH):   %s   4.08
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALKQLAAAVALALSIQAAQGAAVKEKRATCSNGATVGDASSCAWFDVLDDIQQNLFNGAQCGAEAHESIRLVFHDAIAISPALESQGKFGGGGADGSIILFDDIETNFHPNIGLDEIVNLQKPFIQKHGVTPGDFIAFAGAVAMSNCPGAPQMNFFTGRAPATQAAPDGLVPEPFHTVDQIISRVNDAGEFDELELVWMLSAHSVAAANDVDPTIQGLAFDSTPGVFDSQFFVETQLRGTAFPGSGGNQGEVESPLPGEMRLQSDSSIARDSRTACEWQSFVNNQSKLVSDFQFIFLALTQLGENPDAMTDCSDVIPISKPVPNNVPFSFFPAGKTMADVEQACAETPFPTLTTLPGPETSVQRIQPPPGA

Retrieve as FASTA  
Remarks Complete sequence from Genomic (9 introns). Slightly different sequence found with genomic DNA (QRIQPPPGA --> QRIPPPGA): NCBI M77508, SwissProt Q01787.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTTAAGCAACTCGCTGCTGCCGTCGCTCTCGCACTCTCGATCCAGGCTGCCCAAGGTGCGGCATCTACTCCATATCCTTGTCCCCCCGTACTGACCTCGATGCAGGCGCTGCTG
TGAAGGAGAAGCGCGCCACCTGCTCCAACGGCGCGACTGTCGGCGACGCGTCGTCGTGCGCCTGGTTTGACGTTCTCGACGACATCCAGCAGAACCTCTTCAACGGCGCCCAGTGTGGTG
CTGAGGCTCACGAGTCCATTCGTCT
GTAAGTGCCTCCGCTTGTTTCGGTCTAGAGCCTACTCACCGCGTCTACAGTGTCTTCCACGACGCCATCGCTATCTCGCCTGCCCTTGAGTCTCA
AGGCAAATTCGG
GTCGCGTCCTCTCTCCGTTTGACTGCAGGGGGTCGCTGAGTGTAGCATAGTGGTGGAGGCGCTGATGGCTCCATTATCCTCTTCGACGATATCGAGACCAACTTTCAC
CCCAACATTGGCCTTGACGAGATTGTCAACCTGCAGAAGCCCTTCATCCAGAAGCACGGCGTTACTCCTGGCGATTTCATTGCCTTTGCTGGCGCCGTCGCCATGAGCAACTGCCCTGGT
GCTCCGCAGATGAACTTCTTCACCGGTCGTGCTCCTG
GTATGTGTTGAGCACCCCAGCGTGGAATCAGTCTGACACTTGTCCTGCAGCTACTCAGGCCGCTCCAGACGGCCTCGTTCCCG
AGCCATTCC
GTACGTCAGCTGCACAGATACGCATATACACCCGCTGACCAACTCTTACAGACACTGTCGACCAGATCATCTCTCGCGTCAACGACGCTGGCGAGTTTGACGAGCTTGAGC
TCGTCTGGATGCTGTCTGC
GTAAGTTGCAATCCGGCTGTTCTACACTGACAGAGCTGACCACACGCCACAGTCACTCCGTCGCTGCGGCGAACGATGTCGATCCGACGATCCAGGGGCTT
GCGTTCGACTCTACCCCGGGTGTCTTCGACTCGCAGTTCTTCGTTGAGACACAGCTTCGCGGCACGGCGTTCCCCGGCTCGGGTGGCAACCAGGGTGAGGTTGAATCCCCTCTCCCCGGT
GAGATGCGCCTCCAGTCCGACTCCTCGATCGCCCGCGACTCGCGCACGGCGTGCGAGTGGCAGTCCTTCGTCA
GTGCGTATTACATGTGCATCCTAGGGCGAGTGGTCAGACGCTGAGTT
TGCGCCGTAGACAACCAGTCGAAGCTCGTTAGCGACTTCCAGTTCATCTTCCTCGCCCTTACCCAGCTCGGCGAGAACCCGGATGCTATGACCGACTGCTCAGACGTGATCCCGATCTCG
AAGCCGGTCCCCAACAACGTCCCGTTCTCGTTCTTCCCGGCTGGCAAGACCATGGCTGATGTTGAGCAGGCG
GTGCGTAGCAACTCACGTCTACCATATTGCTGCAGGAGCTAACTTATG
CACAGTGTGCTGAGACGCCCTTCCCGACTCTGACGACGCTTCCTGGCCCCGAGACCTCGGTGCAGCGCATGTAAGTACTTTCTGATGCCAATGTACAAGCACCAAGGCACTAACGGTCCA
TTGCAGCCAGHCCTCCTCCGGGTGCTTAA

Retrieve as FASTA