Entry information : PcLiP10_RP78 (lipJ / PcLiPJ_RP78)
Entry ID 2417
Creation 2006-07-05 (Christophe Dunand)
Last sequence changes 2011-11-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PcLiP10_RP78 (lipJ / PcLiPJ_RP78)
Name (synonym) PcLiP10_RP78 (lipJ / PcLiPJ_RP78)
Class Lignin peroxidase    [Orthogroup: LiP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcLiP10_RP78
start..stop
S start..stop
PsoLiP03 587 0 1..369 1..372
PcLiP03_BKMF1767 577 0 1..369 1..371
PcLiP03_RP78 569 0 1..369 1..372
PsoLiP07 566 0 1..369 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 439914..439974 61 N° 2 440030..440180 151 N° 3 440233..440289 57 N° 4 440342..440556 215
N° 5 440607..440648 42 N° 6 440701..440779 79 N° 7 440836..440961 126 N° 8 441015..441130 116
N° 9 441184..441424 241 N° 10 441483..441504 22  
join(439914..439974,440030..440180,440233..440289,440342..440556,440607..440648, 440701..440779,440836..440961,441015..441130,441184..441424,441483..441504)


exon

Literature and cross-references PcLiP10_RP78 (lipJ / PcLiPJ_RP78)
Literature Stewart,P. and Cullen,D. Organization and differential regulation of a cluster of lignin peroxidase genes of Phanerochaete chrysosporium J. Bacteriol. 181 (11), 3427-3432 (1999)
Protein ref. UniProtKB:   Q9UW80
DNA ref. JGI genome:   scaffold_19 (439914..441504)
mRNA ref. JGI transcript:   131709 [Incorrect splicing]
Protein sequence: PcLiP10_RP78 (lipJ / PcLiPJ_RP78)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   369 (348)
PWM (Da):   %s   38924.16 (36640.9)  
PI (pH):   %s   4.52 (4.46) Peptide Signal:   %s   cut: 22 range:22-369
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSVKQFFVVLSTALFLSTVQGAAIEKRATCSNGKTVSSAACCAWFPILQDIQENLFNGGQCGAEAHESLRLVFHDAIAISPALEAQGKFGGGGADGSIMVFDTIETNFHPNIGLDEIVRLQKPFVQKHGVTPGDFIAFAGAVGLSNCPGAPQMNFFLGRPPTKAAPDGLVTEPFHSVDQILARMADAGEFDELETVWLLSAHSVAAANDVDPTRNGLPFDSTPGIFDTQFFVETQLAGTTFPGSGGNQGEVMSPLAGEMRLQSDFLIARDTRTACEWQSFNNQSKLTSDFQFIFAALSTLGHDMTTMTDCSDVIPISKPLRGDSARFPAGKSMKDVEPACAETPFPTLATAPGPATSVARVPPPPGA

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (9 introns), Adjacent to lipH. Strain="BKM-F-1767" and "RP-78".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGTCAAGCAGTTTTTCGTCGTTCTATCTACCGCGCTGTTCCTCAGCACGGTTCAAGGCCTGTTTCACAGTTCTCAATAACGCGAGCCACAGTCCTGACGGTGACGAACTAGGTGC
TGCCATCGAGAAGCGTGCAACCTGCTCGAACGGCAAGACGGTATCCAGCGCAGCATGCTGCGCCTGGTTCCCCATTCTGCAGGACATCCAGGAGAACCTCTTCAACGGCGGCCAATGCGG
CGCCGAGGCACATGAGTCTCTCCGCCT
GTGAGGACTCCGTCAGCCTCAGGTTGGTTTTCCCAGCTGACACGGCCCACAGTGTATTCCACGACGCCATCGCGATCTCTCCCGCGCTGGAGG
CTCAGGGCAAATTCGG
GTACAGTCTCAACGGCATACATTGTACATTGATGCTGACAGTGCATCTTCAGCGGCGGAGGTGCCGACGGCTCCATCATGGTCTTCGATACTATCGAGACCAAT
TTCCACCCGAACATCGGTCTCGACGAAATCGTCCGCCTGCAGAAACCGTTCGTCCAGAAGCACGGTGTTACTCCTGGCGACTTCATCGCATTTGCTGGTGCGGTCGGACTCAGCAACTGC
CCCGGTGCGCCACAAATGAACTTCTTCCTCGGTCGCCCAGCTC
GTGAGTCGTTTGTGATTGAAATATGGGCGCACCTCATGTACCGAATCTAGCGACCAAGGCCGCTCCGGACGGTCTTG
TCACAGAACCCTTCC
GTACGTACCGAAATCTGCGGATGCGAAGTTGCTCACCAGAAGCATACAACAGACTCCGTCGATCAAATCCTGGCTCGGATGGCCGACGCTGGCGAGTTTGACGAA
CTCGAGACTGTCTGGCTGCTCTCGGC
GTAAGCTTCTCCGCGTTATGTGCGTATGTTGGTGTATTTACCACCCATGTGCGTAGGCATTCTGTCGCTGCCGCCAACGACGTCGACCCTACTC
GGAATGGATTGCCTTTCGATTCCACCCCTGGAATCTTCGATACGCAATTCTTTGTCGAGACACAGCTTGCTGGTACCACATTCCCCGG
GTTCGTCTTTCCATTGATCTGTGTACGTGCGT
TCTGACCGGTCGCTCCTGCAGCTCTGGCGGCAACCAAGGGGAAGTGATGTCACCGCTCGCCGGCGAAATGCGTCTCCAATCCGATTTCCTCATCGCTCGCGATACACGCACCGCTTGCGA
GTGGCAGTCCTTCGTCA
GTACGTACCTGCTCACGCCCCTGCAGCGACGCGTGCGCTGACCGCAGACACAGACAACCAGTCGAAGCTCACGAGCGACTTCCAATTCATCTTCGCCGCTCTC
TCGACGCTGGGACATGACATGACCACGATGACCGACTGCTCGGATGTTATCCCGATCTCGAAGCCGCTCCGTGGCGACTCCGCGCGCTTCCCCGCCGGCAAGAGCATGAAAGACGTCGAG
CCTGCCTGTGCCGAGACACCCTTCCCGACTCTCGCGACCGCACCTGGTCCTGCGACTTCGGTTGCTCGCGT
GTATGCGCTGCCTTGCACGTCGTGCGATGATGTTTTTGCTGACTACGCG
TTTCTATAGGCCGCCCCCGCCCGGTGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGTCAAGCAGTTTTTCGTCGTTCTATCTACCGCGCTGTTCCTCAGCACGGTTCAAGGTGCTGCCATCGAGAAGCGTGCAACCTGCTCGAACGGCAAGACGGTATCCAGCGCAGCA
TGCTGCGCCTGGTTCCCCATTCTGCAGGACATCCAGGAGAACCTCTTCAACGGCGGCCAATGCGGCGCCGAGGCACATGAGTCTCTCCGCCT
TGTATTCCACGACGCCATCGCGATCTCT
CCCGCGCTGGAGGCTCAGGGCAAATTCGG
CGGCGGAGGTGCCGACGGCTCCATCATGGTCTTCGATACTATCGAGACCAATTTCCACCCGAACATCGGTCTCGACGAAATCGTCCGCCTG
CAGAAACCGTTCGTCCAGAAGCACGGTGTTACTCCTGGCGACTTCATCGCATTTGCTGGTGCGGTCGGACTCAGCAACTGCCCCGGTGCGCCACAAATGAACTTCTTCCTCGGTCGCCCA
GCTC
CGACCAAGGCCGCTCCGGACGGTCTTGTCACAGAACCCTTCCACTCCGTCGATCAAATCCTGGCTCGGATGGCCGACGCTGGCGAGTTTGACGAACTCGAGACTGTCTGGCTGCTC
TCGGC
GCATTCTGTCGCTGCCGCCAACGACGTCGACCCTACTCGGAATGGATTGCCTTTCGATTCCACCCCTGGAATCTTCGATACGCAATTCTTTGTCGAGACACAGCTTGCTGGTACC
ACATTCCCCGG
CTCTGGCGGCAACCAAGGGGAAGTGATGTCACCGCTCGCCGGCGAAATGCGTCTCCAATCCGATTTCCTCATCGCTCGCGATACACGCACCGCTTGCGAGTGGCAGTCC
TTCGTCA
ACAACCAGTCGAAGCTCACGAGCGACTTCCAATTCATCTTCGCCGCTCTCTCGACGCTGGGACATGACATGACCACGATGACCGACTGCTCGGATGTTATCCCGATCTCGAAG
CCGCTCCGTGGCGACTCCGCGCGCTTCCCCGCCGGCAAGAGCATGAAAGACGTCGAGCCTGCCTGTGCCGAGACACCCTTCCCGACTCTCGCGACCGCACCTGGTCCTGCGACTTCGGTT
GCTCGCGT
GCCGCCCCCGCCCGGTGCTTAA

Retrieve as FASTA