Entry information : TvLiP07_PRL572 (LP7 / LPGVI)
Entry ID 2421
Creation 2006-07-05 (Christophe Dunand)
Last sequence changes 2011-10-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-10-05 (Christophe Dunand)
Peroxidase information: TvLiP07_PRL572 (LP7 / LPGVI)
Name (synonym) TvLiP07_PRL572 (LP7 / LPGVI)
Class Lignin peroxidase    [Orthogroup: LiP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvLiP07_PRL572
start..stop
S start..stop
TvLiP07 750 0 1..368 1..368
TvLiP12_PRL572 541 0 1..365 1..365
TvLiP12 541 0 1..365 1..365
TvLiP10 531 0 1..364 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 354..414 61 N° 2 473..680 208 N° 3 747..881 135 N° 4 940..1486 547
N° 5 1548..1622 75 N° 6 1679..1743 65 N° 7 1801..1816 16  
join(354..414,473..680,747..881,940..1486,1548..1622,1679..1743,1801..1816)


exon

Literature and cross-references TvLiP07_PRL572 (LP7 / LPGVI)
Literature Johansson,T., Welinder,K.G. and Nyman,P.O.Isozymes of lignin peroxidase and manganese(II) peroxidase from the white-rot basidiomycete Trametes versicolor. II. Partial sequences, peptide maps, and amino acid and carbohydrate compositions Arch. Biochem. Biophys. 300 (1), 57-62 (1993
Protein ref. UniProtKB:   Q99057
DNA ref. GenBank:   Z30667
Protein sequence: TvLiP07_PRL572 (LP7 / LPGVI)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   368 (347)
PWM (Da):   %s   39207.22 (37175.1)  
PI (pH):   %s   4.52 (4.47) Peptide Signal:   %s   cut: 22 range:22-368
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKALLSAVSLMAALQGASAALTRRVACPDGKNTATNAACCSLFAVRDDIQQNLFHGAQCGENAHESLRITFHDAISFSPAMEARGQFGGGGADGSIAIFPDIETNFHANIGLDEIVAEQAPIQARHNLSHADFIMFAGALGTSNCPGAPRLDFFLGRKDATRPAPDGLVPEPFDTLEDVFARLADASAGEFDEILTVWLLTAHTIAATDHLDPTIPGTPMDSTPHIWDTQFFIETQLRGTAFPGTGGNHGEVMSPLKGEIRLQTDHLLARDSRTSCEWQSFVNNQQKAQDMFAFVFHDLSMLGQDPDSLIDCSEIPQPAPVIGKAHFPAGLTNKDIEQACADTPFPTLPTDPGPKTTVAAVPINS

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns). Strain="PRL 572".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTCAAAGCTCTTCTCTCCGCCGTCTCGCTTATGGCGGCCCTTCAGGGCGCGAGCGGTAGGCTCCTCAGCCATTTTTAATCAAAACGGCATATGCTCATCACCTCTTGCGCTAGC
TGCGCTGACGCGCCGCGTCGCTTGCCCCGACGGCAAGAACACCGCGACCAACGCGGCGTGCTGCTCGCTCTTCGCCGTCCGCGACGACATCCAGCAGAACCTATTCCACGGTGCCCAGTG
CGGCGAGAACGCGCACGAGTCCCTCCGCATCACCTTCCACGACGCCATCAGTTTCTCGCCCGCCATGGAGGCCCGCGGCCAGTTCGG
GTACGTCGAACCGCATCACCGCCCACCCCACTA
GTGGTACATGATTCGCTGACGGTGGCCATGCAGCGGTGGAGGCGCAGACGGCTCTATTGCCATCTTCCCCGACATCGAGACCAACTTCCACGCGAACATCGGTCTTGACGAAATCGTCGC
TGAGCAGGCGCCGATTCAGGCGCGCCACAACCTCTCGCACGCTGACTT
GTGAGTGCTCTCATTTGTATGTTCCGGTTAGTGCCCTTACAAGCCGGCCCTTTCTTAGCATCATGTTCGCGG
GTGCTCTCGGCACATCCAACTGCCCCGGCGCCCCTCGCCTCGACTTCTTCCTCGGCCGCAAGGACGCGACGCGCCCTGCGCCCGACGGGCTCGTGCCTGAGCCGTTCGACACGCTCGAGG
ACGTCTTCGCACGTCTCGCAGACGCGTCCGCCGGCGAGTTCGACGAGATCCTGACGGTGTGGCTGCTCACCGCGCACACGATCGCGGCGACGGACCACCTGGACCCGACGATCCCGGGCA
CGCCGATGGACTCGACGCCGCACATCTGGGACACGCAGTTCTTCATCGAGACGCAGCTGCGCGGGACCGCGTTCCCGGGCACGGGCGGCAACCACGGCGAGGTGATGTCGCCGCTGAAGG
GCGAGATCCGGCTGCAGACGGACCACCTGCTCGCGCGCGACTCGCGCACGAGCTGCGAGTGGCAGTCGTTCGTGAACAACCAGCAGAAGGCGCAGGACATGTTCGCGTTCGTGTTCCACG
ACCTCTCGATGCTCGGCCAGGACCCGGACAGCCTCATCGACTGCAGCGAGCTG
GTGAGTAATACTCGGAAGCCTTTGGAAAGCGGTAGGGTGCTGACGAGCGTGGCTCGTGTAGATCCCG
CAACCCGCTCCCGTCATCGGCAAGGCGCACTTCCCCGCTGGCCTCACCAACAAGGACATCGAGCAGGCG
GTACGCTTAACTTTTGAATATTTTCCAGTGAGCTTCACTCAAGCGAGGGCA
TTTAGTGCGCGGACACCCCCTTCCCCACGCTCCCGACCGACCCTGGCCCCAAGACCACCGTCGCCGCCGTGTAAGTCGCCCATTTTATTGCGCACCTGTCCTCCCGCTCACTTCAGGGAT
GATGCAGCCCCATCAACTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTCAAAGCTCTTCTCTCCGCCGTCTCGCTTATGGCGGCCCTTCAGGGCGCGAGCGCTGCGCTGACGCGCCGCGTCGCTTGCCCCGACGGCAAGAACACCGCGACCAACGCGGCG
TGCTGCTCGCTCTTCGCCGTCCGCGACGACATCCAGCAGAACCTATTCCACGGTGCCCAGTGCGGCGAGAACGCGCACGAGTCCCTCCGCATCACCTTCCACGACGCCATCAGTTTCTCG
CCCGCCATGGAGGCCCGCGGCCAGTTCGG
CGGTGGAGGCGCAGACGGCTCTATTGCCATCTTCCCCGACATCGAGACCAACTTCCACGCGAACATCGGTCTTGACGAAATCGTCGCTGAG
CAGGCGCCGATTCAGGCGCGCCACAACCTCTCGCACGCTGACTT
CATCATGTTCGCGGGTGCTCTCGGCACATCCAACTGCCCCGGCGCCCCTCGCCTCGACTTCTTCCTCGGCCGCAAG
GACGCGACGCGCCCTGCGCCCGACGGGCTCGTGCCTGAGCCGTTCGACACGCTCGAGGACGTCTTCGCACGTCTCGCAGACGCGTCCGCCGGCGAGTTCGACGAGATCCTGACGGTGTGG
CTGCTCACCGCGCACACGATCGCGGCGACGGACCACCTGGACCCGACGATCCCGGGCACGCCGATGGACTCGACGCCGCACATCTGGGACACGCAGTTCTTCATCGAGACGCAGCTGCGC
GGGACCGCGTTCCCGGGCACGGGCGGCAACCACGGCGAGGTGATGTCGCCGCTGAAGGGCGAGATCCGGCTGCAGACGGACCACCTGCTCGCGCGCGACTCGCGCACGAGCTGCGAGTGG
CAGTCGTTCGTGAACAACCAGCAGAAGGCGCAGGACATGTTCGCGTTCGTGTTCCACGACCTCTCGATGCTCGGCCAGGACCCGGACAGCCTCATCGACTGCAGCGAGCTG
ATCCCGCAA
CCCGCTCCCGTCATCGGCAAGGCGCACTTCCCCGCTGGCCTCACCAACAAGGACATCGAGCAGGCG
TGCGCGGACACCCCCTTCCCCACGCTCCCGACCGACCCTGGCCCCAAGACCACC
GTCGCCGCCGT
CCCCATCAACTCTTAA

Retrieve as FASTA