Entry information : HaAPx03 (HanXRQChr17g0544251)
Entry ID 2600
Creation 2006-01-23 (Nenad Bakalovic)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaAPx03 (HanXRQChr17g0544251)
Name (synonym) HaAPx03 (HanXRQChr17g0544251)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation Peroxisomal
Tissue type Germinating seeds
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaAPx03
start..stop
S start..stop
LsaAPx02 553 0 1..285 1..285
CiAPx02 541 0 1..282 1..282
GhyAPx02 516 0 1..284 1..285
HargAPx03 508 0 1..285 1..284
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 36695910..36696022 113 N° 2 36696091..36696215 125 N° 3 36697803..36697852 50 N° 4 36698024..36698089 66
N° 5 36698315..36698363 49 N° 6 36699584..36699666 83 N° 7 36699768..36699847 80 N° 8 36699939..36700041 103
N° 9 36700807..36700995 189  
join(36695910..36696022,36696091..36696215,36697803..36697852,36698024..36698089 ,36698315..36698363,36699584..36699666,36699768..36699847,36699939..36700041,367 00807..36700995)


exon

Literature and cross-references HaAPx03 (HanXRQChr17g0544251)
Literature Kozik,A. et al., Lettuce and Sunflower ESTs from the Compositae Genome Project, unpublished
DNA ref. HanXRQ genome:   HanXRQChr17 (36695910..36700995)
EST ref. GenBank:   BU032190.1 Heliagene:   HaT13l001732
Cluster/Prediction ref. HanXRQ:   HanXRQChr17g0544251 UniGene:   Han.4445
Protein sequence: HaAPx03 (HanXRQChr17g0544251)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   285
PWM (Da):   %s   31302.16 Transmb domain:   %s   o256-278i
PI (pH):   %s   6.64
Sequence 326
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMPIVDTEYLKQIDKARRELRAFIANKNCAPIMLRLAWHDAGTYDVNTKTGGPNGSIRTEEEYSHGSNNGLKIAIDFCEEIKSKHPRITYADLYQLAGVVAVEVTGGPTVDFVPGRQDSTVSPKEGRLPNATKGAPHLRDIFYRMGLSDKDIVALSGGHTLGRAHPERSGFEGPWTREPLKFDNSYFIELLKGESEGLLKLPTDIALLDDPAFRPYVDLYAKDEDAFFNDYALSHKKLSELGFTPSSKTVIKDGVVLAQSAVGVLVTAAVVILSYLYEARKKTK

Retrieve as FASTA  
Remarks Complete sequence from genomic and 10 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGATGCCTATTGTAGACACCGAATACCTTAAACAGATTGATAAAGCTCGTCGGGAGCTTCGTGCTTTTATCGCCAACAAGAATTGCGCACCAATCATGCTTCGATTAGCGTAAGTCT
TAAACATACATACATGCATGTATGACTGTATTGAAATTGATTATGATGATGTTGTTGTAGGTGGCATGATGCTGGAACATACGATGTGAATACGAAAACCGGAGGTCCCAACGGTTCGAT
TAGAACAGAGGAGGAGTATAGTCATGGCTCTAACAATGGATTGAAGATTGCTATCGATTTTTGCG
GTCAATTTTTCTTTCTTATTAGGTCTTTGTGTGTCAAGTCGGGAGTACTTTAGTT
TTTTCAACTGCAGGAATTAGTAACGTTGATATTGTTTGGCTGTTGTTGCTAGATATATAATATCACCACACTTACAGGATATGCTTAGTATTTTTGCAAGTAGGTTTAGGATTTGGAGGA
TATCCCTCCGGGCTTAAGCTTAAGGGGGCGTTTGGTTCGCGGGATGATTTGGAATTGGAATTGGAATTTGTATAGGAATTAGAATTTGAAGGAATTGGATTTGGAATTTAAACATTCCAA
TTGGAATTGGAATCTCAATTCCATTTTTGTTGTGTTTGGTTGTCAAATGAATTGGAATCCATCACCCCGGCACCCACAACCACCAGTTCGGGTCGAAACGGTATGTGTCGAAACGGTTCG
ATTCGAAACGGTACAAGTCAAAACGGTACGGGTCGAAACGGTTCGCGTCGAAACGGTTCGATTCGAAATGGTACGGGTCGAAACTGTTCTCGTCGAAACGTTACGGGTCGAAACGGTACG
GATTGAAACGGTGCGGGTCGAAACGTTCGAAGATTCCAATGAATTTACTTTAATTCCTTCACATATAGGAAGGATTTTGAATTACTTTAGTTAAAGGAATTTGAAGGAATTCAAGCCTAA
TTCCAATTCCAATTCCATTGTCAACCAAACACATGAAGATTGGAATTGAGATTCCAATTCCATCAAATTCTGTGAACCAAACATCTTAAGAGATGGAATTCAAATTCCAATTCCATTGAA
TTCCAGCGAACCAAGCATTGTTGTTCATGCTGCAAACTTAAAATGAGTTCACATGCGCCAATTTAAGTAAATAAAATGACAGTGTCCCACTGGGTGAACCTATGTTATCAAAGGCGTGCA
CCTACAGGGCAGCCCAGCGCAGCATTTGCGCTATGCTCTCAAAGGTGCGGTCGCAAGTTCAAAGCATTTTCTGATTCTGGCCCAAAATGTTTAAAAAGGCTGGAATTATAACCTAAATAA
GCATGAAATCGACCCAAGACAGCCCTAAACAAGCCTAAAACATGTTTAAAACCCCCAAAAATGGCATTTTATACTATGCACCTGGCTTAAAAAAGCCCTCCGCTTTTTAAGTGCCTGGCG
CTTAGGGTCCAGGCCAGGCCTATGCACCTTGAGTGTGCCTTTACGCCATGACAACATAGGGGTGGACAAGGGGCTTCATAGCTTATTGGTCTATAGTGAAGAACTTAAAGTTACTAGAAC
ATTGGTTTGATGATTTTAGGCTGACTTGTATTGGAACTGGTCAACTGGATATTGATGAGTTATCTTAAAAGTGCACACCCCTATCCGAAACCGTCTTGTGTAGGTGATAAAAGGTTTAGT
TAAAGGACTTGAGCTCAAAACTTAAAAGCATTTTGTTTACTGTCAAGATTGAAATTGAACTCCTTAAACTGAGGCTTGTTGTGTTTCCACTTTCAATCTTTACAGCATTCTTGATAGATT
TGCTGTGTTATCTATAAAGAGAAAAGATATATACTTGAATAAACTACTTCTCCTGTTTGTTGCTTTAATGTGTATCCTCTTTCTTACCGCAGAGGAAATAAAGTCCAAACATCCAAGGAT
TACTTATGCAGATCTATATCAG
GTGCATTCATTGATGCTAAAGAAGTTTGTATTGATACATTTAGACATAGGGGTTTCTAGTTTATTGTTTTGTGGTAACTTAACTCCTATTGTAACATA
TACACAAGCGCACACGGTATATAAAATGTGAAATGTAACTTACGGCTCACCACGAAAGGATCTCTGTTTGTAGCTTGCGGGAGTTGTTGCTGTGGAGGTTACTGGTGGCCCTACTGTTGA
CTTTGTTCCTGGTAGACAG
GTATCATGATTTATCACATTAGTTTTTCAAGTTTTTCTGTCAAGGTTCATTTCTTTTATTTTTCTTGCTTCTCTCCTGCACGACTGGTCACATATCGTATC
GTTTTATGCTTAATTTCTTTTTGAAATGTTACTCTCTAGACGACGCACATATATAAGAACGCGATGGGAATTATTCTTTCAGTAAATCTACTCTTCATTAACAAACTCTTATCTTTTTTT
CTAGGACTCAACGGTCTCTCCCAAGGAAGGCAGACTCCCAAATGCTACCAAAGGTTTTTGATCCTTATTTTATTCTTAATAAAATCTTTTATAAGAACTGAGGCCTATTTTAAATAGTGT
CTCGGTAGTTACAAGATGATTCTTCGATCAGCGTCTCGTTCCTGATCTGAAACAGTTATATCGTTGACACGATTAATGAGTTTATAATTATAACTGTAATGACATCACTACAGTTGAAGG
GTGGTTTTTGTTCATCACCCACCAATGCAAGACTTGCCAATCAGTCATTGGCTAATTGCATGGTACCCTAATCTCACTCGGATGACAGATGATATGATTAAACGAATTCAAAGAACTGAA
GGGAATCCTGAAATGGGTATTCTTTAATATTTCATAAACTCAAAACAAACTAACATAATGATCCCGATTGGCTGAAAGACGCCTTACATCCTTTGGATTGACGATGCGAATTTTGTTAAA
TACAGACACCGGAAATGTTGAGAGAAAATTTGTAAGATGGTTGTTTGTGATTGCATTATAAAGATCTCTTGCTGATCCTACTGTACAGTTCAGCATCTGTTGTTTTCCCACTTCTGTATT
AATTGATTTTAACCGTCCTTGTATATAAGCAATAGTTGTCTAGTAATAAACAAGCTATTCACTAGACATATCAGTATCATAATAACACACATATATACTTTGTTAACTTTGATGAGGTAA
TATTGGTTAAAACCCCAATGCCTCTCAGGAAAGCATCGCCTCTTGTGTTGAGCAATTTATCCGTTTCCCCTTGATCAACAAGGGTGTTTTGGACATTTTGCTATGGTACTAATTTCTGAT
ATTGTTGAAAGTAGTCTATTTTCTCAACAAACAAGATTTTATCGATATCTTCATGAATGCGTATATCCAAAGGATTATATGAACACACGCCAAAATTTTTTGGACCTTCTACTTTATCTT
CTAGAAGCAATTGTATTTTGCAAAACTCATGCCAACATAATCAAGTGAAACAATTGAAATACCTATGAATCTATGATGAATATTGACATGAACACTTGTTATATGCTAAAGTCAAACAAA
TACTGTTACTTATTTACCAACAATCATTTTCATTTCGTATTACTTTCTACAAAGCTCAACTTGTCTGTGAAGGATTTCACAAGGTCAAGTGTCCACTGGGAACTTTGTGTTATTGTTTAC
GTATTAATGTATTATACTCGTTACTTTCATCAATATGATAGGTTTTTAATTTTTCTAACATGTACTGATTTAGGTGCACCACACTTGCGGGACATATTTTACCGCATGGGTTTATCTGAC
AAGGATATTGTAGCCCTATCTGGAGGACACACCCTT
GTACGTTGCTAGTTTCTTGTTAGACGAATACCTTAATAATACTCTTTTTTCCATTCATGTTAATGTTTTTCTTGTTTCTTGCTG
AATTTTTGACGTTGCAGGGAAGAGCACATCCTGAAAGATCGGGCTTCGAAGGCCCTTGGACTAGGGAGCCACTGAAATTCGATAACTCATACTTCATGTAAAACTGGATGAAGCTTCACT
ATCATTCTCATTTATACTAAAATAATCATTTTCTATATACTAATACGACACTAATACTGTGAAACCAGTGAACTTCTGAAAGGCGAATCAGAGGGGCTACTAAAACTTCCTACAGACATC
GCATTGCTGGATGATCCTGCGTTCCGTCCTTACGTTGACCTGTACGCCAAG
GTATACCGTTTTCTTGTGTGGACGAGTTTGACTCAGTTAACAACACAATTTTCGACTCAATAAGTTGCG
ACAACAATGGCGGATATGTAAACCTAACTAGAAACTTTTACTATTTAACCATAATAACTTTAAAGTTTAAAGTTTAAACAACCAGCCCCCACACGCACCACCCCAACAGACATCCTTTAA
TAGGGTAGGAACCTACCTTAACGACTAAAATGGGAACCTATAACCAAACAAACATTAAAGCCAAATACAGTTGTGTGTTTGGTTTTGCCTAGATTGACAGTTGGGACCCTCTCTGGACTC
TGACTAATGGTCTGCTCCCATTATCTGTCCCCACCCACCCTAACCTCCATTTCAACTTGCAAATAATAATAAAACACACTCACCTGTTGCCAACAACCTTTGCACAGATTGTGCTCTTAT
TCAGGTACATTGTAAGTCATATGAAACTAAATCCTCCTGGCTGCAACATGACTTAGGTTCCTTCCTTCTTACACTAATTTTAAACTAATACTTGTACAGTACATTCTCTTAATGCCACAA
TTAATCTCATTTGACTTTTTTATTTGATTGGTTGTTAACACATCTTTTTCCAAATTTATACCTTATTATTATATGGGATGACTAAAATGGTATTTTATGAGTTGGTAGGCGTCCTTTTCA
TTATATATTAAATATATTGATTTAACTGTACGTTTTTTCCATGTTCTGCTTAATTATTGAACATTATTTATTTATTTTTTTATATTTTATTTTCAGGATGAAGATGCATTCTTTAATGAC
TATGCATTATCACACAAGAAACTCTCTGAATTAGGATTTACACCAAGCTCTAAAACAGTAATTAAGGACGGAGTCGTATTGGCGCAAAGCGCTGTTGGTGTTTTGGTTACTGCTGCTGTG
GTGATTCTGAGCTACCTCTATGAAGCCCGCAAAAAGACCAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGATGCCTATTGTAGACACCGAATACCTTAAACAGATTGATAAAGCTCGTCGGGAGCTTCGTGCTTTTATCGCCAACAAGAATTGCGCACCAATCATGCTTCGATTAGCGTGGCATG
ATGCTGGAACATACGATGTGAATACGAAAACCGGAGGTCCCAACGGTTCGATTAGAACAGAGGAGGAGTATAGTCATGGCTCTAACAATGGATTGAAGATTGCTATCGATTTTTGCG
AGG
AAATAAAGTCCAAACATCCAAGGATTACTTATGCAGATCTATATCAG
CTTGCGGGAGTTGTTGCTGTGGAGGTTACTGGTGGCCCTACTGTTGACTTTGTTCCTGGTAGACAGGACTCAA
CGGTCTCTCCCAAGGAAGGCAGACTCCCAAATGCTACCAAAG
GTGCACCACACTTGCGGGACATATTTTACCGCATGGGTTTATCTGACAAGGATATTGTAGCCCTATCTGGAGGACACA
CCCTT
GGAAGAGCACATCCTGAAAGATCGGGCTTCGAAGGCCCTTGGACTAGGGAGCCACTGAAATTCGATAACTCATACTTCATTGAACTTCTGAAAGGCGAATCAGAGGGGCTACTAA
AACTTCCTACAGACATCGCATTGCTGGATGATCCTGCGTTCCGTCCTTACGTTGACCTGTACGCCAAG
GATGAAGATGCATTCTTTAATGACTATGCATTATCACACAAGAAACTCTCTG
AATTAGGATTTACACCAAGCTCTAAAACAGTAATTAAGGACGGAGTCGTATTGGCGCAAAGCGCTGTTGGTGTTTTGGTTACTGCTGCTGTGGTGATTCTGAGCTACCTCTATGAAGCCC
GCAAAAAGACCAAGTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTGTGGAGAT GAAGGTCAAA CACACAAACC AATGAACTCG ACCACAGAAG ATCACTTCTT CTGTTTTTAG CCTATCCATC TATAATATCT TCAGTGGTGT GTGTGCTCTT CCCAAGACTC  CACAGACACT CGCACTTTCA CCTTCACTGT GTGCATAATC AATGGCGATG CCTATTGTAG ACACCGAATA CCTTAAACAG ATTGATAAAG CTCGTCGGGA GCTTCGTGCT TTTATCGCCA  ACAAGAATTG CGCACCAATC ATGCTTCGAT TAGCGTGGCA TGATGCTGGA ACATACGATG TGAATACGAA AACCGGAGGT CCCAACGGTT CGATTAGAAC AGAGGAGGAG TATAGTCATG  GCTCTAACAA TGGATTGAAG ATTGCTATCG ATTTTTGCGA GGAAATAAAG TCCAAACATC CAAGGATTAC TTATGCAGAT CTATATCAGC TTGCGGGAGT TGTTGCTGTG GAGGTTACTG  GTGGCCCTAC TGTTGACTTT GTTCCTGGTA GACAGGACTC AACGGTCTCT CCCAAGGAAG GCAGACTCCC AAATGCTACC AAAGGTGCAC CACACTTGCG GGACATATTT TACCGCATGG  GTTTATCTGA CAAGGATATT GTAGCCCTAT CTGGAGGACA CACCCTTGGA AGAGCACATC CTGAAAGATC GGGCTTCGAA GGCCCTTGGA CTAGGGAGCC ACTGAAATTC GATAACTCAT  ACTTCATTGA ACTTCTGAAA GGCGAATCAG AGGGGCTACT AAAACTTCCT ACAGACATCG CATTGCTGGA TGATCCTGCG TTCCGTCCTT ACGTTGACCT GTACGCCAAG GATGAAGATG  CATTCTTTAA TGACTATGCA TTATCACACA AGAAACTCTC TGAATTAGGA TTTACACCAA GCTCTAAAAC AGTAATTAAG GACGGAGTCG TATTGGCGCA AAGCGCTGTT GGTGTTTTGG  TTACTGCTGC TGTGGTGATT CTGAGCTACC TCTATGAAGC CCGCAAAAAG ACCAAGTGAT TAAAATGTCA AACATGAAAC AAGGTACAAC TTTCTATGCA GGGGATACAG GTTACTGTGC  TATTATTGTT ATGTTCTAAA CTCCAGACAA CTTGACTTTG GGTTTGATTA GTTAATGGAC TCATACACAA TATACTAATG TGTACGTACT TAAATTCCTT TGTGTTGGGT TTATTAATAT 
AACCTAGTTT TAAATCTGGC AAAAAAAA 

Retrieve as FASTA