Entry information : SbPrx57 (Sobic.003G140400.1 [2.1] / SB03G011960 [1.4])
Entry ID 2704
Creation 2006-01-12 (Christophe Dunand)
Last sequence changes 2006-01-12 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx57 (Sobic.003G140400.1 [2.1] / SB03G011960 [1.4])
Name (synonym) SbPrx57 (Sobic.003G140400.1 [2.1] / SB03G011960 [1.4])
Class Class III peroxidase    [Orthogroup: Prx237]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx57
start..stop
S start..stop
ZmPrx127 534 0 1..322 1..317
SiPrx25 533 0 20..331 20..330
RcPrx04 297 4e-100 5..329 8..329
RcPrx02 296 1e-99 24..329 28..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13707490..13707717 228 N° 2 13706585..13707352 768  
complement(join(13706585..13707352,13707490..13707717))


exon

Literature and cross-references SbPrx57 (Sobic.003G140400.1 [2.1] / SB03G011960 [1.4])
Literature PlanGDB
DNA ref. Phytozome 12:   chromosome_3 (13707717..13706585)
Protein sequence: SbPrx57 (Sobic.003G140400.1 [2.1] / SB03G011960 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (305)
PWM (Da):   %s   34999.15 (32298.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.45 (4.43) Peptide Signal:   %s   cut: 27 range:27-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSRGSDVMLLLLVALHALLPAIVTDAALQEGFYTSNTNCTVDVEATVVSVVQQFISADRGVGAGLIRLHFHDCFVKGCDGSVLLDRSPANPDPEKASPANGGLRGLEVIQEAKRQLESACPGTVSCADILAFAARDASNILSSGAINYGVPSGRRDGLTSAASDASQSLPPPFAQLDRLTELFAAKGFTQDELVTLSGAHSVGRAHCASFSQRIHPNVSDTMDQEYGAGLQQQCPADAGDDGVAPVDQDQGTPAELDNQYYRNVIDGKVLFNSDWALISDDTTRQMVADNAGNQARWAAKFIDAMRKMGTLDVLTGDQGEVRRFCNVTNSG*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, intron 1). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCACGCGGCTCTGACGTGATGCTGCTGCTCTTGGTAGCCCTCCATGCGCTTCTGCCGGCAATCGTCACTGATGCCGCTCTGCAGGAAGGTTTCTACACGAGCAACACCAATTGCACC
GTCGACGTCGAGGCCACCGTGGTGAGCGTCGTCCAGCAGTTCATCTCCGCGGATCGTGGCGTCGGCGCTGGCCTCATACGGCTCCACTTCCACGACTGTTTCGTCAAG
GTATAATACGTG
TACCAGAACATAATTTGCACACTATATTCTCGAATCTGGATTGAAGATAGACGATTAAATCGACATGCATGATTATACTGCCAGCAACTAATGAATTGCTGCACATATGATTCTGTACGT
GCCAGGGTTGCGATGGTTCGGTTCTCCTTGACCGGAGCCCTGCCAACCCGGACCCGGAGAAGGCGTCGCCGGCGAACGGCGGCCTCCGCGGGCTGGAGGTGATCCAGGAAGCCAAGCGGC
AGCTCGAGAGCGCGTGCCCGGGGACCGTCTCCTGCGCCGACATCCTCGCGTTCGCCGCGCGCGACGCGTCCAACATCCTGAGCTCCGGGGCGATCAACTACGGCGTCCCGTCCGGCCGCC
GGGACGGGCTCACCTCGGCGGCGTCCGACGCCAGCCAGAGCCTGCCCCCGCCGTTCGCGCAGCTCGACCGTCTCACGGAGCTCTTCGCCGCCAAGGGGTTCACGCAGGACGAGCTCGTCA
CGCTCTCCGGCGCGCACTCCGTCGGCCGCGCTCACTGCGCGTCCTTCTCGCAGCGGATACACCCCAACGTCAGCGACACCATGGACCAGGAGTACGGCGCCGGGCTGCAGCAGCAGTGCC
CCGCCGACGCCGGGGACGACGGGGTGGCGCCGGTGGACCAGGACCAGGGCACACCGGCCGAGCTCGACAACCAGTATTACAGGAACGTGATCGACGGGAAGGTGCTCTTCAACTCCGACT
GGGCGCTCATCAGCGACGACACGACGAGACAGATGGTGGCGGACAACGCGGGAAACCAGGCTCGGTGGGCGGCCAAGTTCATCGACGCCATGCGCAAGATGGGCACCTTGGACGTGCTCA
CAGGCGACCAGGGCGAAGTGAGACGTTTCTGCAACGTCACCAATAGCGGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCACGCGGCTCTGACGTGATGCTGCTGCTCTTGGTAGCCCTCCATGCGCTTCTGCCGGCAATCGTCACTGATGCCGCTCTGCAGGAAGGTTTCTACACGAGCAACACCAATTGCACC
GTCGACGTCGAGGCCACCGTGGTGAGCGTCGTCCAGCAGTTCATCTCCGCGGATCGTGGCGTCGGCGCTGGCCTCATACGGCTCCACTTCCACGACTGTTTCGTCAAG
GGTTGCGATGGT
TCGGTTCTCCTTGACCGGAGCCCTGCCAACCCGGACCCGGAGAAGGCGTCGCCGGCGAACGGCGGCCTCCGCGGGCTGGAGGTGATCCAGGAAGCCAAGCGGCAGCTCGAGAGCGCGTGC
CCGGGGACCGTCTCCTGCGCCGACATCCTCGCGTTCGCCGCGCGCGACGCGTCCAACATCCTGAGCTCCGGGGCGATCAACTACGGCGTCCCGTCCGGCCGCCGGGACGGGCTCACCTCG
GCGGCGTCCGACGCCAGCCAGAGCCTGCCCCCGCCGTTCGCGCAGCTCGACCGTCTCACGGAGCTCTTCGCCGCCAAGGGGTTCACGCAGGACGAGCTCGTCACGCTCTCCGGCGCGCAC
TCCGTCGGCCGCGCTCACTGCGCGTCCTTCTCGCAGCGGATACACCCCAACGTCAGCGACACCATGGACCAGGAGTACGGCGCCGGGCTGCAGCAGCAGTGCCCCGCCGACGCCGGGGAC
GACGGGGTGGCGCCGGTGGACCAGGACCAGGGCACACCGGCCGAGCTCGACAACCAGTATTACAGGAACGTGATCGACGGGAAGGTGCTCTTCAACTCCGACTGGGCGCTCATCAGCGAC
GACACGACGAGACAGATGGTGGCGGACAACGCGGGAAACCAGGCTCGGTGGGCGGCCAAGTTCATCGACGCCATGCGCAAGATGGGCACCTTGGACGTGCTCACAGGCGACCAGGGCGAA
GTGAGACGTTTCTGCAACGTCACCAATAGCGGCTAA

Retrieve as FASTA