Entry information : LuPrx01 (FLXPER1|Lus10008173|PACid:23173793)
Entry ID 273
Creation 2006-06-23 (Christophe Dunand)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-18 (Christophe Dunand)
Peroxidase information: LuPrx01 (FLXPER1|Lus10008173|PACid:23173793)
Name (synonym) LuPrx01 (FLXPER1|Lus10008173|PACid:23173793)
Class Class III peroxidase    [Orthogroup: Prx119]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue types Leaves
Seedlings
Stems
Inducer Lignification
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx01
start..stop
S start..stop
LuPrx149 682 0 8..359 5..354
LuPrx151 584 0 1..359 1..360
LuPrx42 571 0 17..359 18..372
LuPrx45 520 0 8..358 4..355
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 136563..136784 222 N° 2 135307..135498 192 N° 3 134618..134786 169 N° 4 134004..134500 497
complement(join(134004..134500,134618..134786,135307..135498,136563..136784))


exon

Literature and cross-references LuPrx01 (FLXPER1|Lus10008173|PACid:23173793)
Literature REFERENCE 1
A anionic, stem-specific flax peroxidase cDNA with C-terminal motifs also found in a blue copper-type pea protein correlated with lignin deposition. Aust. J. Plant Physiol. 23, 773-789 (1996).
REFERENCE 2
Day A1, Fénart S, Neutelings G, Hawkins S, Rolando C, Tokarski C. Identification of cell wall proteins in the flax (Linum usitatissimum) stem. Proteomics. 2013 13(5):812-25.
Protein ref. UniProtKB:   Q42905
DNA ref. Phytozome 12:   scaffold480 (136784..134004)
mRNA ref. GenBank:   L07554
Protein sequence: LuPrx01 (FLXPER1|Lus10008173|PACid:23173793)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360 (333)
PWM (Da):   %s   38172.91 (35310.4)  
PI (pH):   %s   4.47 (4.46) Peptide Signal:   %s   cut: 27 range:27-359
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLFLNKFVVSSLVAMLLFAGASYAQQLTPTFYDSTCPNVIGIVRTVLQNAAMADPRIGASLNRLHFHDCFVNGCDGSLLLDNSATILSEKQALGNNNSVRGFDVVDQMKTQVEAACPGVVSCADILAIASEESVVLAGGPSWAVPLGRRDSLTANRSLADDQLPPPFFTVDELKANFATVGLNTTEDLVALSGAHTFGRARCVGFVGRLYNFNSTGGPDPTINATFLETLRQICPQNGNGSVLTNLDRTTADAFDSNYFTNLQTREGLLQTDQELISTPGSDTIELVNRFAANQTAFFQSFVNSMIRMGNIPPPPGSPSEIRRNCRVVNSASVADTIVTTTTTPTGSVGTDGFASDM*

Retrieve as FASTA  
Remarks Complete sequence from genomic and mRNA. anionic perox. Strain="Stormont Cirrus". Experimental evidency of cell wall localization
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCATTATTTCTCAACAAGTTTGTGGTTTCGTCGTTGGTGGCGATGCTATTATTCGCTGGAGCGAGCTACGCGCAGCAGCTTACTCCTACGTTCTACGACTCGACTTGTCCGAAC
GTTATCGGCATCGTCCGTACAGTTCTTCAGAATGCTGCCATGGCCGATCCGAGAATCGGTGCCAGCCTCAACAGGCTTCACTTCCATGATTGCTTTGTTAAT
GTAAGTACACTACTACTA
CATGCGTACCTCTATATATATATGCTTATACAATTGGTTTCATGTTCTTCTTATAGTAATAAAAAAAACATAGTAGTAAAAAAATCTTGGTGTTTGTTTACAATGGCGGAACTGGTGGCG
GACTTGGATCGCTGTCCAGACCCGGTTTTTAAAGAGACGGAATTTCACGTAAAATTTTGTAAAATTGGAATTTTTGTCAGGTACATTTTCGTATTTCTCTATAGTGTGCTTCCAAACTTT
AAAAATAAAATTCCATCCAGAATTTCGGACCATTTTCATTAGTTACATGTTCTTCCGTTAATAGTACTAAAAAGTAAAAACGCTATAATAATAGACAAAAATCATGGTATGTTGCTTATA
ATGACAGAATGAGGTGTGAACTTAGACCACTGTCCAGACTCTTTCGATTTTACATTTACAAAATCCTATTTTGTAAAATTGGAGCTTTTGACTCGTATTTGCCCAAAATCTTTTACCGAC
CGTTATAGTTTCGGTATTGATTGATTATGAAACTATGTATACATGAACAAAAAAGCACAAGGATACAAATTAGGGAAAAAGTGTCAACCTCCCGCTATAAAGAGGCCAAAGGCTGAACTT
TCAACATTGATATTTGTTTGGTCCATAATAGATATATATCATGTGGTAATTAATATAACTGTCGGTATTGGATATATATGCTTTCCCAAGTATAGAAAAATAAAGAATATTCCTTTCCTA
TAAATTTATCAATTGTTTCTCGAAATGATATAATATTAATATCTAAATTTTATTACAGTTTAATCATGTATTTATAACGATATAAACAGTTGAATTTCAAATTTAAATTACACTGAATGC
GTGTTTGATGTTTTGATATGGTCCTGAAAAAACATGCTGTATTATTTCTTTAATTTACATTTCTTCAAGTCTACATCCAAATTAAATTCCAGCTAGCATTGCATGCATGGGGACAAGTAT
TGAATGCTACGTAATAGTACTTCTTTTGGTGGGGGTATGTATGTAATTTTCTTGATCTGAGGGCATGTATGTAATTTAACATGCAGGGATGTGATGGATCTCTGTTGCTGGACAACAGCG
CCACCATACTAAGCGAGAAACAGGCGCTTGGCAACAACAACTCCGTTAGAGGGTTCGACGTCGTGGACCAAATGAAGACCCAAGTCGAAGCTGCTTGCCCCGGGGTTGTTTCTTGTGCCG
ATATTCTCGCCATCGCTTCTGAGGAATCCGTTGTTTTG
GTACGTCAAATCTTCGGAACCTCTCTATTTAGATTTGATAATGTCGTATGTACTTATAGATTCATCTAAAATGGAAAGAAGA
GGAAAGGAAACAATGTCTAACTTCTATAACGATTTAAATGGTTAAATCATTTATTATTAGATTCACCGCTAATTTATGAAAGATAAAATAATTAACACATAATATATAGGTCAATAATAG
TAACTAATTATGGTCCCACGTGTCCCTTTTGTCTACTAACTAAATTAAATGAATTGGCACTTTAATGTACAACAACTACGAACTACCCTAATTAGAGCTAGGGCTTTTCTGATTGTGACT
ATTCAAAAATTTGACTCAACAAATATACAAAGTCATATATAGATGATATTTTTTCTAGTTAGATATATAGTTAGAATTAATTTATTGCTTTTGAGATTCGGTATTCCAAACTATACCGAA
TATGTGATTTAATTACTTAAATTGTTATTGAATCGTAGTTCAATTTGATTGTGTGACAAATACTATGTAATTATATAGGCAGGAGGGCCGTCATGGGCAGTTCCATTGGGGAGGAGAGAC
AGCTTGACAGCAAACCGGAGTCTAGCAGATGACCAACTTCCTCCTCCATTTTTCACCGTCGATGAGCTCAAAGCTAATTTCGCTACCGTTGGCCTCAACACCACCGAAGACCTCGTTGCT
CTCTCAG
GTATCATAATACTAATATACTACCTGGACCTTGTCCATTGTATCACCTGAATAAGGTATCTATTATTAATATTATCTATATTAGTACTAATTAATTCTTTGTTATGGGCTTAA
TTAGGTGCTCACACATTCGGAAGGGCCCGATGCGTAGGATTCGTGGGCCGGCTCTACAACTTCAACAGCACGGGCGGCCCAGACCCAACAATCAACGCCACATTCCTCGAAACACTCCGC
CAGATCTGCCCTCAGAACGGAAACGGCAGCGTTTTGACCAACCTCGACCGGACAACTGCCGACGCTTTCGATTCGAACTACTTCACCAATCTCCAGACCCGTGAAGGACTCCTCCAGACT
GACCAGGAACTGATCTCCACTCCAGGCTCCGACACTATTGAGCTCGTCAACAGGTTCGCCGCCAACCAGACGGCCTTCTTCCAGAGCTTTGTCAATTCCATGATTAGGATGGGGAACATT
CCGCCTCCGCCCGGGAGTCCCAGTGAGATTAGGCGGAATTGCAGGGTCGTGAACTCTGCCTCCGTTGCTGATACGATTGTTACTACTACTACTACTCCGACGGGTTCTGTTGGTACGGAT
GGGTTTGCGAGTGACATGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCATTATTTCTCAACAAGTTTGTGGTTTCGTCGTTGGTGGCGATGCTATTATTCGCTGGAGCGAGCTACGCGCAGCAGCTTACTCCTACGTTCTACGACTCGACTTGTCCGAAC
GTTATCGGCATCGTCCGTACAGTTCTTCAGAATGCTGCCATGGCCGATCCGAGAATCGGTGCCAGCCTCAACAGGCTTCACTTCCATGATTGCTTTGTTAAT
GGATGTGATGGATCTCTG
TTGCTGGACAACAGCGCCACCATACTAAGCGAGAAACAGGCGCTTGGCAACAACAACTCCGTTAGAGGGTTCGACGTCGTGGACCAAATGAAGACCCAAGTCGAAGCTGCTTGCCCCGGG
GTTGTTTCTTGTGCCGATATTCTCGCCATCGCTTCTGAGGAATCCGTTGTTTTG
GCAGGAGGGCCGTCATGGGCAGTTCCATTGGGGAGGAGAGACAGCTTGACAGCAAACCGGAGTCTA
GCAGATGACCAACTTCCTCCTCCATTTTTCACCGTCGATGAGCTCAAAGCTAATTTCGCTACCGTTGGCCTCAACACCACCGAAGACCTCGTTGCTCTCTCAG
GTGCTCACACATTCGGA
AGGGCCCGATGCGTAGGATTCGTGGGCCGGCTCTACAACTTCAACAGCACGGGCGGCCCAGACCCAACAATCAACGCCACATTCCTCGAAACACTCCGCCAGATCTGCCCTCAGAACGGA
AACGGCAGCGTTTTGACCAACCTCGACCGGACAACTGCCGACGCTTTCGATTCGAACTACTTCACCAATCTCCAGACCCGTGAAGGACTCCTCCAGACTGACCAGGAACTGATCTCCACT
CCAGGCTCCGACACTATTGAGCTCGTCAACAGGTTCGCCGCCAACCAGACGGCCTTCTTCCAGAGCTTTGTCAATTCCATGATTAGGATGGGGAACATTCCGCCTCCGCCCGGGAGTCCC
AGTGAGATTAGGCGGAATTGCAGGGTCGTGAACTCTGCCTCCGTTGCTGATACGATTGTTACTACTACTACTACTCCGACGGGTTCTGTTGGTACGGATGGGTTTGCGAGTGACATGTAG

Retrieve as FASTA