Entry information : LuPrx04(FLXPER4|Lus10003573|PACid:23165480)
Entry ID 275
Creation 2006-06-23 (Christophe Dunand)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx04(FLXPER4|Lus10003573|PACid:23165480)
Name LuPrx04(FLXPER4|Lus10003573|PACid:23165480)
Class Class III peroxidase     [Orthogroup: Prx018]*
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue types Leaves
Seedlings
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx04
start..stop
S start..stop
PatrPrx01 486 3e-175 5..305 15..316
PtPrx53 481 3e-173 5..305 15..316
LePrx72 472 8e-170 3..305 17..320
AcoPrx64 471 2e-169 1..305 11..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 30958..31134 177 N° 2 31420..31611 192 N° 3 31845..32393 549  
join(30958..31134,31420..31611,31845..32393)


exon

Literature and cross-references LuPrx04(FLXPER4|Lus10003573|PACid:23165480)
Literature Omann,F. and Tyson,H.
cDNA sequence of a basic peroxidase (FLXPER4) in flax
Unpublished
Protein ref. UniProtKB:   O65029
DNA ref. Phytozome 12:   scaffold536 (30958..32393)
mRNA ref. GenBank:   AF049881
Protein sequence: LuPrx04(FLXPER4|Lus10003573|PACid:23165480)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   305
PWM (Da):   %s   32297.05  
PI (pH):   %s   8.21
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
FAMSLLASSGSAQLAANFYATSCPTLLTIVRNAMTQAVNSENRMAASILRLHFHDCFVNGCDGSLLLDDTATFTGEKNAGPNQNSVRGFDIIDTIKTRVEAACNATVSCADILALAARDGVVLVGGPTWTVPLGRRDARTASQSAANAQIPAPGSSLGTITNLFTNKGLTARDVTILSGAHTIGQARCTTFRQRIYNDTNIDPAFATTRRGNCPQAGAGANLAPLDGTPTQFDNRYYQDLVARRGLLHSDQELFNNGTQDALVRTYSNNAATFATDFAAAMVRMGNISPLTGTNGEIRFNCRRPN*

Retrieve as FASTA  
Remarks cationic peroxidase. Partial cDNA, small part of the 5' is missing. Cultivar="Stormont cirrus". Partial sequence from genomic. Incorrect prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTCGCCATGTCACTGCTGGCCTCTTCAGGAAGCGCTCAGCTCGCCGCCAACTTCTACGCCACCTCATGCCCAACCCTCCTTACTATTGTCCGCAATGCCATGACTCAAGCCGTTAATAGC
GAAAACCGCATGGCCGCCTCCATCCTCCGTCTCCACTTTCATGACTGCTTCGTTAAT
GTACGTAATACATATGTCAATACGCTACATTTCCATGTTTGCATATAAGTTTTTCAACATATA
ATCTGATGTTCTATGAATATTAACTACTTATATCTACCCCATGCACCTTAATTTGTGATATATATATTGTCACTTCAAAACTTGGTCAACGGCTGATACTATTGTTATGATCGTAAAAAT
ATCTACCCGTCGGGTGGTCCAAATTAAATCGTTCTAATTGTACACATTAAATTATCATTATTAATTTTTTTTATCTTATCTATTTGATTATCGTGTTGGCAGGGTTGTGATGGGTCGCTA
CTGTTGGACGATACTGCCACTTTCACTGGCGAGAAGAACGCAGGACCCAACCAAAACTCTGTTAGAGGGTTCGACATAATAGACACGATCAAGACCAGAGTTGAGGCAGCATGCAACGCC
ACCGTGTCTTGCGCTGACATCCTTGCTCTCGCAGCCAGAGACGGTGTCGTATTG
GTAAGAATTCCGAAATATATGCGGAAATTCTCAAATAGCATGCATGCAAAATTCGATACATCACTT
TTTTTACCTCACATTTTAACCTAGTTAACCAAACAGTAAAAACCGTACGTTCGGGTGAGTAATAATAAGTAACAACTATTAATTCCTTTCAGCACGTAACTATTTTTATCGTTACATGAA
AAGTCTAAATTGTAATCAATTAATCATTGTGTTTCTATTCCGAGCAGGTAGGCGGGCCCACATGGACGGTCCCACTAGGCCGACGCGACGCGCGGACGGCGAGCCAGAGCGCAGCCAACG
CACAAATCCCAGCCCCAGGGTCAAGCCTAGGAACGATAACCAACTTGTTCACGAACAAGGGCCTCACCGCCCGTGACGTCACAATCCTGTCGGGGGCCCACACGATCGGGCAGGCGCGTT
GCACCACGTTCCGCCAGCGGATCTACAACGACACCAACATCGACCCGGCGTTCGCCACCACCCGGAGGGGGAACTGCCCGCAGGCCGGAGCCGGAGCCAACCTCGCACCGCTGGACGGAA
CCCCGACCCAGTTCGACAACAGGTATTACCAGGATCTGGTGGCGAGGCGCGGGCTGCTCCATTCGGATCAGGAGCTGTTCAACAACGGGACTCAGGACGCGCTGGTGAGGACTTACAGCA
ACAATGCGGCTACTTTTGCTACGGATTTCGCCGCCGCTATGGTGAGGATGGGGAACATCAGCCCGTTGACCGGGACCAACGGGGAGATCAGATTTAACTGCAGGAGGCCTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTCGCCATGTCACTGCTGGCCTCTTCAGGAAGCGCTCAGCTCGCCGCCAACTTCTACGCCACCTCATGCCCAACCCTCCTTACTATTGTCCGCAATGCCATGACTCAAGCCGTTAATAGC
GAAAACCGCATGGCCGCCTCCATCCTCCGTCTCCACTTTCATGACTGCTTCGTTAAT
GGTTGTGATGGGTCGCTACTGTTGGACGATACTGCCACTTTCACTGGCGAGAAGAACGCAGGA
CCCAACCAAAACTCTGTTAGAGGGTTCGACATAATAGACACGATCAAGACCAGAGTTGAGGCAGCATGCAACGCCACCGTGTCTTGCGCTGACATCCTTGCTCTCGCAGCCAGAGACGGT
GTCGTATTG
GTAGGCGGGCCCACATGGACGGTCCCACTAGGCCGACGCGACGCGCGGACGGCGAGCCAGAGCGCAGCCAACGCACAAATCCCAGCCCCAGGGTCAAGCCTAGGAACGATA
ACCAACTTGTTCACGAACAAGGGCCTCACCGCCCGTGACGTCACAATCCTGTCGGGGGCCCACACGATCGGGCAGGCGCGTTGCACCACGTTCCGCCAGCGGATCTACAACGACACCAAC
ATCGACCCGGCGTTCGCCACCACCCGGAGGGGGAACTGCCCGCAGGCCGGAGCCGGAGCCAACCTCGCACCGCTGGACGGAACCCCGACCCAGTTCGACAACAGGTATTACCAGGATCTG
GTGGCGAGGCGCGGGCTGCTCCATTCGGATCAGGAGCTGTTCAACAACGGGACTCAGGACGCGCTGGTGAGGACTTACAGCAACAATGCGGCTACTTTTGCTACGGATTTCGCCGCCGCT
ATGGTGAGGATGGGGAACATCAGCCCGTTGACCGGGACCAACGGGGAGATCAGATTTAACTGCAGGAGGCCTAATTAA

Retrieve as FASTA