Entry information : MtPrx88 (Medtr7g086870.1[4.0] / Medtr7g103680.1[3.0])
Entry ID 2797
Creation 2006-01-30 (Christophe Dunand)
Last sequence changes 2006-01-30 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx88 (Medtr7g086870.1[4.0] / Medtr7g103680.1[3.0])
Name (synonym) MtPrx88 (Medtr7g086870.1[4.0] / Medtr7g103680.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx055]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx88
start..stop
S start..stop
GmPrx124 420 3e-149 1..312 2..310
GmPrx125 412 5e-146 5..311 3..310
PpePrx32 395 3e-139 21..311 21..316
PtPrx38 393 4e-138 1..311 1..307
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 33789515..33789715 201 N° 2 33790927..33791664 738  
join(33789515..33789715,33790927..33791664)


exon

Literature and cross-references MtPrx88 (Medtr7g086870.1[4.0] / Medtr7g103680.1[3.0])
Literature Town,C.D., Tallon,L.J., Arbogast,T., Althoff,R., Hine,E., Monaghan,E., Smith,S.A., Utterback,T., Feldblyum,T., Koo,H. and Cheung,F. Medicago truncatula BAC genomic sequence, Unpublished.
DNA ref. Phytozome 12:   chr7 (33789515..33791664)
Cluster/Prediction ref. Phytozome Gene 12:   31078803
Protein sequence: MtPrx88 (Medtr7g086870.1[4.0] / Medtr7g103680.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   312 (292)
PWM (Da):   %s   34308.61 (31968.3) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.22 (8.00) Peptide Signal:   %s   cut: 21 range:21-312
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKPTILLIFLMFLLFPFAFGDLKVGFYSSSCPRAELIVRQVVERSFNQDRSMTAALLRMHFHDCFVRGCDASILIDSKKGNESEKAARANLTVRGYNLIDEIKRILENACPSTVSCADIISLATRDSVVLAGGPSYNVPTGRRDGLVSTVNDVHLPGPESSISQTLQAFKSKGMTLEEMVTLLGAHTVGFAHCSFIGKRLGSNDSSMDPNLRKRLVQWCGVEGKDPLVFLDQNTSFVFDHQFYNQILLGRGVLTIDQNLALDSISKGVVTGFARNGENFRERFVDAVVKLGNVDVLVGNQGEIRKNCRVFNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, intron 1). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCCAACAATTTTATTAATCTTCTTAATGTTCTTGCTCTTTCCCTTTGCATTTGGTGATCTCAAAGTTGGATTTTATAGCTCTAGCTGCCCAAGAGCAGAGTTGATTGTACGTCAA
GTTGTTGAGAGAAGTTTTAATCAAGATAGATCCATGACTGCTGCCTTGCTCCGTATGCACTTCCATGATTGCTTTGTCAGA
GTAAGCTCCAAACTAACCTAATTAATCATATCATTATGA
AAATGGATCCTCTGAGAAAACATTACAAAAATTTTGACCATTAATCTCTACATTATCAATAATGTAGAGATCAATGGTCAAGATCTCCACGTTATTTTTCAAAAAAATTCATTTTAGAGA
ATATTAATCCACTCCAATGATATATACATTAGTTTTACTCTCTTTCCAAACAATTATTTGTCCCTAAATTTGAGATGATCTACAAAATATTTCATACATGAATGTTTTCTTTGAAAATAT
AATTAATTTACCAGTTAAAATGCAAGTTATTTTTTCTTTCTTATGATATTAATAATTTTTTTTTAAGAAGTATGATATTAATAATTTATAAAAATACATATGTAAAAGTGACACATATCA
TCAAGAAATTCATCACTCCAACAAGTTTTTTTAATATCAATATTTTTTGTTAAATCTTTTTATAATACAAGACAAAATTCATATACTAATAAATAAAAAAATCAATTCAATTCCCCTCTA
TGCTCATGGTCCTAAATATAGGGATCTACATTCATAAATTTGATTACAAAATATTTCTTTTGAAATCTGTAAATTCATATGGCAGTTTGGTTTTTTCAATTTCCAATTTTTTTCCTCACA
TTATTGCCTAGATTTTGATAGAATATATTACTTTAAACTGAAATAATCACATAATTTTTTTTATTATCATCACTGCAAATTAAAGAATAACCTAATGATGGAAGAAATAAAAAATGCCTC
TAATTTAAATTGTTATTGACTTTAGTTTTGTGATGATACAAGATTAACAGAATTGTCGATTAATAATTGTTACAAAAAGGAGTTTCATTTAAAGAGAACCTTCCATAAAAAACTGTTTTA
TATTTTTAATTTCTTTTTAAATATTATTTTAGAGAAAAAAAAATCACATTTATATTCTTCCATTTCGCGGACAGTATTCTTCCTAAATAATAACATTGCTCTTAGATAAATATATATTTG
GTCCATTTTTAATTGTTCTTGTCATATAATTTTTTTAATGACTTCATTCCTTAAAAAAAGTATAACTCGTTCGGTCTTTTATTTCACAATGAATAATGGTGACCACATCAATTGCATATT
TTTAGGCAGCTGCATATTTATCTTACTCTACACATATACTTACCAAAATATACAATATTTTGTCATGACCAATTTGGTTGATTTAATTTCAGGGGTGTGACGCATCCATATTAATAGACT
CAAAGAAGGGCAATGAATCAGAGAAAGCAGCAAGAGCAAACCTTACTGTAAGAGGATATAACCTCATAGATGAAATCAAAAGAATCCTAGAAAATGCATGTCCATCAACAGTTTCATGTG
CAGACATAATATCATTAGCAACAAGAGATTCTGTTGTCTTAGCAGGTGGACCAAGTTACAATGTTCCTACAGGAAGACGTGATGGATTAGTATCAACTGTTAATGATGTACATCTTCCAG
GGCCAGAATCCTCAATTTCTCAAACATTACAAGCTTTTAAATCCAAAGGTATGACATTGGAAGAAATGGTTACACTTTTAGGAGCACACACTGTTGGATTTGCTCATTGTAGTTTCATTG
GAAAAAGACTTGGTAGTAATGATAGTTCAATGGACCCTAATTTAAGAAAAAGGTTGGTTCAATGGTGTGGTGTTGAAGGTAAGGATCCATTAGTGTTTTTGGATCAAAACACTTCTTTTG
TTTTTGATCATCAATTTTATAATCAGATTTTGTTGGGGAGAGGTGTGTTAACAATTGACCAGAATTTGGCTCTAGATTCCATTTCCAAAGGGGTTGTCACAGGTTTTGCAAGAAATGGTG
AGAATTTTAGGGAGAGATTTGTTGATGCAGTGGTTAAATTGGGAAATGTTGATGTTTTGGTTGGTAATCAAGGAGAGATTAGGAAGAACTGCAGAGTTTTTAATTCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCCAACAATTTTATTAATCTTCTTAATGTTCTTGCTCTTTCCCTTTGCATTTGGTGATCTCAAAGTTGGATTTTATAGCTCTAGCTGCCCAAGAGCAGAGTTGATTGTACGTCAA
GTTGTTGAGAGAAGTTTTAATCAAGATAGATCCATGACTGCTGCCTTGCTCCGTATGCACTTCCATGATTGCTTTGTCAGA
GGGTGTGACGCATCCATATTAATAGACTCAAAGAAGGGC
AATGAATCAGAGAAAGCAGCAAGAGCAAACCTTACTGTAAGAGGATATAACCTCATAGATGAAATCAAAAGAATCCTAGAAAATGCATGTCCATCAACAGTTTCATGTGCAGACATAATA
TCATTAGCAACAAGAGATTCTGTTGTCTTAGCAGGTGGACCAAGTTACAATGTTCCTACAGGAAGACGTGATGGATTAGTATCAACTGTTAATGATGTACATCTTCCAGGGCCAGAATCC
TCAATTTCTCAAACATTACAAGCTTTTAAATCCAAAGGTATGACATTGGAAGAAATGGTTACACTTTTAGGAGCACACACTGTTGGATTTGCTCATTGTAGTTTCATTGGAAAAAGACTT
GGTAGTAATGATAGTTCAATGGACCCTAATTTAAGAAAAAGGTTGGTTCAATGGTGTGGTGTTGAAGGTAAGGATCCATTAGTGTTTTTGGATCAAAACACTTCTTTTGTTTTTGATCAT
CAATTTTATAATCAGATTTTGTTGGGGAGAGGTGTGTTAACAATTGACCAGAATTTGGCTCTAGATTCCATTTCCAAAGGGGTTGTCACAGGTTTTGCAAGAAATGGTGAGAATTTTAGG
GAGAGATTTGTTGATGCAGTGGTTAAATTGGGAAATGTTGATGTTTTGGTTGGTAATCAAGGAGAGATTAGGAAGAACTGCAGAGTTTTTAATTCTTAG

Retrieve as FASTA