Entry information : MtPrx83 (Medtr5g033470.1[4.0] / Medtr5g033470.1[3.5] / Medtr5g034830.1[3.0])
Entry ID 2826
Creation 2006-12-22 (Christophe Dunand)
Last sequence changes 2006-12-22 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx83 (Medtr5g033470.1[4.0] / Medtr5g033470.1[3.5] / Medtr5g034830.1[3.0])
Name (synonym) MtPrx83 (Medtr5g033470.1[4.0] / Medtr5g033470.1[3.5] / Medtr5g034830.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx184]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Flowers
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx83
start..stop
S start..stop
LjPrx43 463 5e-164 1..377 1..390
GmPrx93 453 3e-160 1..377 1..380
GmPrx107 420 3e-147 58..377 59..380
PpePrx40 257 1e-83 73..377 32..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14415329..14415682 354 N° 2 14413895..14414674 780  
complement(join(14413895..14414674,14415329..14415682))


exon

Literature and cross-references MtPrx83 (Medtr5g033470.1[4.0] / Medtr5g033470.1[3.5] / Medtr5g034830.1[3.0])
Literature REFERENCE 1 Debelle,F., Samain,S., Choisne,N., Saurat,O., Dudez,A., Gouzy,J., Barbe,V., Segurens,B., Wincker,P., Couloux,A., Scarpelli,C., Quetier,F. and Weissenbach,J. Medicago truncatula chromosome 5 sequencing.
REFERENCE 2 Moskal,W., Cheung,F., Xiao,Y. and Town,C.D. Construction and analysis of normalized cDNA library from flowers, seeds and stems of Medicago truncatula (2007).
DNA ref. Phytozome 12:   chr5 (14415682..14413895)
EST ref. GenBank:   EV259025 [5' end]
Cluster/Prediction ref. Phytozome Gene 12:   31087589
Omic ref. Gene atlas:   Mtr.63.1.S1_at Legoo:   Mtr.63.1.S1_at
Protein sequence: MtPrx83 (Medtr5g033470.1[4.0] / Medtr5g033470.1[3.5] / Medtr5g034830.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   377 (354)
PWM (Da):   %s   41777.41 (39219.9)  
PI (pH):   %s   5.78 (5.31) Peptide Signal:   %s   cut: 24 range:24-377
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKVSRIILVTLFLFSLVVVPTNSKKSKKSKKPKKIDFDLDYGFGSGLTVDDQEQKLVDDEKQNPKTGFDKGHLKQGFYSESCPTAEKIVADALVEITKTNPNAIANIIRLQFHDCFVVGCDSSVLLDYTPTGDKVEKSSMLNGQLLKGTDFIDDIKAKLEEQCPGIVSCTDTIAFSVNEGMFLSGLPRTAPLGGRRDALYSLASIAEDDNLPMPNWPMEKMVDLFTKKGFTIEEMVILLGAHSIGVAHCDVFMERIYNYADTRKPDPLLPFPIVNELQQICANPGTPLFRNPVVNFDETPALLDNLFFKNMVTKKKTLLVTDAHLFNDPRTIPIVEELAKDNGLFQKKFAEAMVKMGSYNVITGNDGEVRKTCRSTN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, intron 1) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGTGTCAAGGATCATACTTGTGACCCTTTTCTTGTTTAGCTTGGTCGTTGTTCCTACAAATTCAAAAAAATCAAAAAAATCAAAAAAACCAAAAAAAATTGATTTTGATTTGGAC
TATGGATTTGGATCTGGACTTACTGTTGATGATCAAGAACAAAAACTGGTAGATGATGAAAAGCAAAACCCAAAGACTGGGTTTGATAAAGGTCATCTTAAGCAAGGGTTCTATAGCGAA
AGTTGTCCAACTGCAGAGAAAATCGTGGCTGATGCTCTTGTTGAAATTACGAAGACAAATCCAAACGCAATTGCTAACATTATTCGTCTTCAATTTCACGACTGCTTCGTTGTT
GTAAGC
ATTTCTAAATTTCAACAATCATTGTCTTTTTTTAACATGCGAATTTTGTCTTCTTCGATCTCTTAAATTGATTATTAAATTTGACATCACTAACACATAATAATTCAAAGTAAGAGCGAG
ACTATACCAAAAGGTATGGATTTGAATTATGTTCAAATATGAACAATCACATAGTCTCTGATCATATAGTGAATCAAACAATTCACATTTTGATTGCATATTTTATATCTTATTTATCAA
AGGCATAACATGATTAGTCTAATGTAAATCTCACTGTCTGAATTATATAAGTGTATCATAACAATAATGACATTTGTCGATATGCCACTACGGCCTGTTTACTAAGATCATCATAGATTA
TTAATGTGTGCATTCCATTATCGTGGAAATATTCCCCCATGGCACACCCAGAATATGGGGCCAGAAATTGCAGAAGTGCAGGATCCAAAGCGGTGGTTGCTACAAGAATGGAATATTCTA
AAGCATTCGCTTTAGAATTCAAAGAAATATAAATTATAGTACCAAATAATTCATGTGCCTGAATCCACATGATGAAAAAAAAATACTTTATTATTTAAAAAATTTACTTAACTATGATAT
GTGTTCTATAATTAACTTGGCCATAATGGGAAAAAAATAAATAAACAGGGTTGTGATTCCTCAGTCTTGCTAGACTACACACCAACAGGAGACAAAGTAGAAAAAAGTTCGATGTTAAAT
GGTCAACTTCTCAAAGGAACTGACTTCATTGACGACATTAAAGCAAAACTAGAAGAACAATGTCCGGGAATAGTTTCATGCACAGACACAATAGCATTTTCAGTTAACGAAGGAATGTTC
CTTTCCGGATTACCTCGTACAGCTCCCCTTGGAGGCCGTAGAGATGCGCTCTATTCCCTAGCATCTATCGCGGAAGACGACAACCTTCCAATGCCTAATTGGCCGATGGAAAAAATGGTT
GACCTCTTCACAAAAAAAGGTTTCACAATTGAAGAAATGGTTATTTTACTTGGTGCGCATTCAATTGGTGTGGCTCATTGCGATGTTTTTATGGAAAGGATTTACAATTACGCAGACACG
AGGAAACCTGATCCTTTGCTTCCATTTCCAATTGTTAATGAGCTTCAACAAATATGTGCGAACCCTGGGACACCTCTTTTTAGAAACCCTGTAGTGAATTTCGATGAGACACCAGCGTTG
CTTGACAACTTGTTTTTTAAGAATATGGTGACGAAGAAGAAGACGCTTTTGGTTACAGATGCTCATTTGTTTAATGATCCTAGGACAATTCCTATTGTTGAAGAACTTGCTAAGGATAAT
GGTTTGTTTCAAAAGAAGTTTGCTGAAGCTATGGTTAAGATGGGTTCTTACAATGTTATTACTGGGAATGATGGTGAGGTGAGGAAGACTTGCAGGTCAACTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGTGTCAAGGATCATACTTGTGACCCTTTTCTTGTTTAGCTTGGTCGTTGTTCCTACAAATTCAAAAAAATCAAAAAAATCAAAAAAACCAAAAAAAATTGATTTTGATTTGGAC
TATGGATTTGGATCTGGACTTACTGTTGATGATCAAGAACAAAAACTGGTAGATGATGAAAAGCAAAACCCAAAGACTGGGTTTGATAAAGGTCATCTTAAGCAAGGGTTCTATAGCGAA
AGTTGTCCAACTGCAGAGAAAATCGTGGCTGATGCTCTTGTTGAAATTACGAAGACAAATCCAAACGCAATTGCTAACATTATTCGTCTTCAATTTCACGACTGCTTCGTTGTT
GGTTGT
GATTCCTCAGTCTTGCTAGACTACACACCAACAGGAGACAAAGTAGAAAAAAGTTCGATGTTAAATGGTCAACTTCTCAAAGGAACTGACTTCATTGACGACATTAAAGCAAAACTAGAA
GAACAATGTCCGGGAATAGTTTCATGCACAGACACAATAGCATTTTCAGTTAACGAAGGAATGTTCCTTTCCGGATTACCTCGTACAGCTCCCCTTGGAGGCCGTAGAGATGCGCTCTAT
TCCCTAGCATCTATCGCGGAAGACGACAACCTTCCAATGCCTAATTGGCCGATGGAAAAAATGGTTGACCTCTTCACAAAAAAAGGTTTCACAATTGAAGAAATGGTTATTTTACTTGGT
GCGCATTCAATTGGTGTGGCTCATTGCGATGTTTTTATGGAAAGGATTTACAATTACGCAGACACGAGGAAACCTGATCCTTTGCTTCCATTTCCAATTGTTAATGAGCTTCAACAAATA
TGTGCGAACCCTGGGACACCTCTTTTTAGAAACCCTGTAGTGAATTTCGATGAGACACCAGCGTTGCTTGACAACTTGTTTTTTAAGAATATGGTGACGAAGAAGAAGACGCTTTTGGTT
ACAGATGCTCATTTGTTTAATGATCCTAGGACAATTCCTATTGTTGAAGAACTTGCTAAGGATAATGGTTTGTTTCAAAAGAAGTTTGCTGAAGCTATGGTTAAGATGGGTTCTTACAAT
GTTATTACTGGGAATGATGGTGAGGTGAGGAAGACTTGCAGGTCAACTAATTAA

Retrieve as FASTA