Entry information : PtAPx03(POPTR_0009s02070 / Potri.009G015400.11)
Entry ID 2874
Creation 2006-04-04 (Felipe Teixeira)
Last sequence changes 2006-04-04 (Catherine )
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-15 (Catherine )
Peroxidase information: PtAPx03(POPTR_0009s02070 / Potri.009G015400.11)
Name PtAPx03(POPTR_0009s02070 / Potri.009G015400.11)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue types Buds
Leaves
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtAPx03
start..stop
S start..stop
PbAPx02 509 0 1..249 1..249
QshAPx01 473 5e-172 1..248 1..248
EgrAPx03 469 1e-170 1..249 1..249
AinAPx 466 2e-169 1..249 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2617840..2617958 119 N° 2 2617553..2617727 175 N° 3 2617408..2617473 66 N° 4 2616668..2616716 49
N° 5 2616493..2616575 83 N° 6 2616305..2616384 80 N° 7 2616067..2616169 103 N° 8 2615897..2615955 59
N° 9 2615788..2615803 16  
complement(join(2615788..2615803,2615897..2615955,2616067..2616169,2616305..2616 384,2616493..2616575,2616668..2616716,2617408..2617473,2617553..2617727,2617840. .2617958))


exon

Literature and cross-references PtAPx03(POPTR_0009s02070 / Potri.009G015400.11)
Literature JGI
DNA ref. Phytozome 12:   Chr9 (2617958..2615788)
Cluster/Prediction ref. JGI gene:   650416 UniGene:   Pth.10784
Omic ref. ePlant:   Potri.009G015400
Protein sequence: PtAPx03(POPTR_0009s02070 / Potri.009G015400.11)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   249
PWM (Da):   %s   27230.76  
PI (pH):   %s   5.87
Sequence 290
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTKNYPTVSEEYSKAVEKAKKKLRSLIAEKSCAPLMLRLAWHSAGTFDVKTKTGGPFGTMRYSAELAHGANNGLDIAVRLLESIKEQFPILSYADFYQLAGVVGVEITGGPEVPFHPGREDKPEPPPEGRLPDATKGSDHLRDVFGHMGLSDKDIVALSGGHTLGRCHKERSGFEGPWTANPLIFDNSYFKELLSGEKEGLLQLPSDKALLSDPIFRPYVDKYAADEDAFFADYSEAHLKLSELGFADA

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns), 1 mRNA and 26 ESTs. a very small last exon.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGAAGAACTATCCAACTGTAAGCGAAGAGTACAGCAAAGCCGTTGAAAAGGCCAAGAAGAAGCTGAGAAGCTTGATTGCCGAGAAGAGCTGCGCTCCTCTCATGCTTCGTCTAGCG
TATATTCCCCTTCCCCTTCACCTTTTTATTCTTCTTTTTCCTCTTTCCGTGTAAATGTTTGATTGGATCCGATCCGATCCGATCGGATTGGTTGTTGTGGTTATGATGCAGATGGCACTC
AGCTGGAACCTTCGATGTTAAGACAAAAACCGGTGGGCCCTTTGGTACCATGAGGTACTCGGCAGAGCTGGCACATGGCGCTAACAATGGTCTCGACATTGCTGTCAGACTCCTTGAGTC
CATCAAGGAGCAGTTTCCCATCCTCTCCTATGCCGATTTCTACCAA
GTACTGTCCATTTTATTATCTTTGTTTTTTAAAAGAAAAAATTAATTACTGTGTTTTGATTGGTTTCTTTTCGG
TGTAGCTTGCTGGTGTTGTTGGTGTTGAAATCACTGGTGGTCCTGAGGTTCCTTTCCACCCTGGGAGAGAGGTCAGTAATTTTCTCTTTCTCTTCCTCTGTGTTTGTTTTGTTTTGTTTA
TTTATTGTTTGATCCCCTGCTTTGCTTTTGTATCGCCATTGATTTCTTAGGCAGTCATTACCACGTTAGGTCTAACCTCAGGCTTTTCTGTTTGTTTTTGAAATTTGCATGGTCATTCTT
CAACCTAGTAATTAAAATGGTGGGGAGGGAGCAAGGAGGTGGATTAGTATTTTGGCCTGATGTGTAACAGCAGTGTTTTAACTATTTCATAGCGTTGAACTTTGGATTCATCCACTTTTT
ATTGATTCTTGTTCTTTAAGCTTGACCTAGAATCTCTATTGAATAAATCTCAAACCTCACCGTTTGGTGCTAAAGTTTGCTGCAAATTTTTTAATATTTTCACCTGCTGTACTGTCATGT
CTTGTGTATGTTATGTTTTATGAAGAACGATCAAGCATTGTTCCCCTTGTCTGTGCTAAGAAGATATATGTTCTCTGATAATACAGCGTTATGTTTTGTGAAGAATGAACAAGCATTGTT
CCCCTTGTCTATGCTTTGAAGATCTATGTTCTCTGATAATACAGCATCTTCCTATCTGATGTGATGATTATCAAACGGTGTTGGAGTCCCTCACATTTTAGAGTTTTTGGTCTTAGCAAT
TTGTTCTATCAATTAATTTTCTGCTGCCCTGCTTGATTTCAGGACAAGCCTGAGCCACCTCCAGAAGGCCGTCTGCCTGATGCTACTAAGGGTTTGTTTGCTCCTTGTCAACTTGTCTGC
AATTGGAAAATTTGAAATTGTTTTAGCTCTAAGTCATCGACTCGTTGTATAATGCCTTTTCAGGTTCTGATCACTTGAGGGATGTCTTCGGCCACATGGGCCTCAGTGATAAGGATATTG
TAGCTCTCTCTGGGGGCCACACCCTG
GTCCGTTCCAAGTTTCAAATTGTTTCCTGAAATGATACCTGAGTGCTTGTTGTTTGCCTTTTTTTCACTTATTGGCGCTTGCCATGTTAATAAT
GATGAGTATTGCAGGGAAGGTGCCACAAGGAGCGCTCCGGTTTTGAGGGGCCCTGGACTGCTAACCCTCTCATCTTTGATAACTCTTACTTCAAGTGAGTTCCGTTGGTTGGTTTCCTTC
GGAGCCTTCACTTGTTTTCTGTCATATTTCAGTGCCCAGACATCGAATTTATGCTTGCACTGTTTTGTGTTTCATTTTTCTCACATTGTATGTTTCTAAACTTCGTTAGGGAGCTCTTGA
GTGGGGAGAAGGAAGGGCTTCTACAACTTCCATCTGACAAGGCTCTTCTATCTGACCCTATCTTCCGCCCATATGTTGACAAATATGCTGCT
GTATGTACCAAAAATATCATCTGTTGTG
CTTCAGGCGCTTGCCAGATACATGAAAAATTGCTGGTTTCCTGCTGCTGCTAATGCTGTGTCCTTTCCTCTCTACTTTTTTAGGATGAAGATGCTTTCTTTGCCGATTATTCTGAAGCTC
ATCTGAAGCTCTCCGAACTGGG
GTAACTACAATTTTCAATCTACCTTTTCAATGGTCACGTTACCTGAATTTTTGGACTGCTGCTCATTTGGTAATCTTTGGTGCTTTTTGACAGATTTG
CTGATGCCTA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGAAGAACTATCCAACTGTAAGCGAAGAGTACAGCAAAGCCGTTGAAAAGGCCAAGAAGAAGCTGAGAAGCTTGATTGCCGAGAAGAGCTGCGCTCCTCTCATGCTTCGTCTAGCA
TGGCACTCAGCTGGAACCTTCGATGTTAAGACAAAAACCGGTGGGCCCTTTGGTACCATGAGGTACTCGGCAGAGCTGGCACATGGCGCTAACAATGGTCTCGACATTGCTGTCAGACTC
CTTGAGTCCATCAAGGAGCAGTTTCCCATCCTCTCCTATGCCGATTTCTACCAA
CTTGCTGGTGTTGTTGGTGTTGAAATCACTGGTGGTCCTGAGGTTCCTTTCCACCCTGGGAGAGAG
GACAAGCCTGAGCCACCTCCAGAAGGCCGTCTGCCTGATGCTACTAAGGGTTCTGATCACTTGAGGGATGTCTTCGGCCACATGGGCCTCAGTGATAAGGATATTGTAGCTCTCTCTGGG
GGCCACACCCTG
GGAAGGTGCCACAAGGAGCGCTCCGGTTTTGAGGGGCCCTGGACTGCTAACCCTCTCATCTTTGATAACTCTTACTTCAAGGAGCTCTTGAGTGGGGAGAAGGAAGGG
CTTCTACAACTTCCATCTGACAAGGCTCTTCTATCTGACCCTATCTTCCGCCCATATGTTGACAAATATGCTGCT
GATGAAGATGCTTTCTTTGCCGATTATTCTGAAGCTCATCTGAAG
CTCTCCGAACTGGG
ATTTGCTGATGCCTA

Retrieve as FASTA