Entry information : PtPrx04 (POPTR_0004s14240 / Potri.004G134800)
Entry ID 3082
Creation 2010-03-12 (Catherine Mathe)
Last sequence changes 2010-03-12 (Catherine Mathe)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-07 (Qiang Li)
Peroxidase information: PtPrx04 (POPTR_0004s14240 / Potri.004G134800)
Name (synonym) PtPrx04 (POPTR_0004s14240 / Potri.004G134800)
Class Class III peroxidase    [Orthogroup: Prx026]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx04
start..stop
S start..stop
PtPrx60 573 0 1..316 1..316
GhPrx39 514 0 1..316 9..323
GrPrx39 514 0 1..316 9..323
CsPrx05 510 0 1..316 12..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15508251..15508466 216 N° 2 15508663..15508851 189 N° 3 15508951..15509113 163 N° 4 15509201..15509583 383
join(15508251..15508466,15508663..15508851,15508951..15509113,15509201..15509583 )


exon

Literature and cross-references PtPrx04 (POPTR_0004s14240 / Potri.004G134800)
Literature DOE joint genome institute.
DNA ref. Phytozome 12:   Chr04 (15508251..15509583)
Cluster/Prediction ref. JGI gene:   546604
Omic ref. ePlant:   Potri.004G134800
Protein sequence: PtPrx04 (POPTR_0004s14240 / Potri.004G134800)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (297)
PWM (Da):   %s   34500.02 (32558.9) Transmb domain:   %s   i2-24o
PI (pH):   %s   5.44 (5.81) Peptide Signal:   %s   cut: 20 range:20-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVLANFLGVVLLMELIAGGYRFGADGLSMNYYVFNCPLAEPIVRSTVSSALQSDPTLAAALVRMHFHDCWIQGCDGSILLDSTKDNTAEKDSPGNLSVRGFELIDDVKEQLENQCPGVVSCADIVAMAAREAVSWSGGPVYDIPKGRKDGRRSKIEDTINLPFPTFNASELVRVFGKRGFSAQYMVALSGAHTLGVARCSSFKTRLSDPVDPTMDSDFSKALAKTCSGGDNAEQSFDVTRNNFDSFYFQALQRKAGVLFSDQTLYNNPETKAIVNNYAMNQAMFFLDFQRAMVKMSLLDVKEGSKGEVRADCRKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (3 introns). 4 ESTs from Populus trichocarpa x Populus deltoides
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTGGCTAATTTTCTTGGCGTGGTCTTATTGATGGAGTTAATAGCAGGTGGTTATAGATTTGGAGCAGATGGCCTGAGCATGAACTACTATGTTTTCAATTGCCCGTTAGCAGAG
CCAATTGTGAGGAGCACAGTGTCAAGTGCTTTGCAGTCTGATCCTACCTTAGCAGCTGCTCTTGTTAGAATGCATTTTCATGATTGCTGGATACAA
GTAATCAACCCTTTTCTCTCTTTA
ACTGTTTACGCTCTCAGTGCACATACACCTCTCTCACATTCATGTGGGGTTTACGTGTAGTTTTGTTAAAAGGTTCCACAAGTCAAGTGTTAGGGTTAATATAGATACAAATACCAGCAA
GAGTGTCCAATGATCTCTCTTTGTGTTTGACTGTTGAAATAACTTGAAATAGGGATGTGATGGGTCTATCCTGCTGGACTCAACAAAGGATAACACAGCAGAGAAGGATTCTCCAGGAAA
TCTGAGTGTTAGAGGCTTTGAATTAATTGATGATGTAAAGGAGCAACTTGAAAACCAATGCCCTGGTGTTGTCTCCTGTGCTGATATTGTTGCAATGGCTGCTAGAGAGGCTGTTTCTTG
G
GTAACAAAATTCTTTCAATATTCTGTTTTTTTTTTCTTCTTCTTTCAATGCTTAGCATCTACTGATATATGAATTGTCTGGTGATGGTGGGAATCACAGTCAGGAGGTCCAGTGTATGA
CATACCAAAAGGAAGAAAAGATGGAAGAAGGTCTAAAATTGAAGACACTATCAATTTGCCTTTCCCCACTTTTAATGCCTCTGAGCTCGTTAGAGTCTTTGGCAAACGTGGTTTCAGTGC
CCAATACATGGTTGCTTTGTCTG
GTAAGTATTCATCTTCTTCACCTATCAAATTACTAGGAGTGTCAAGGTGCTCATCGTCGTTCTGTGGTCATCACTTGGTTTATGCAGGGGCACATAC
ACTGGGAGTGGCAAGGTGCTCATCGTTCAAAACTAGGTTGAGTGACCCTGTTGATCCAACTATGGACTCAGACTTTTCGAAGGCATTGGCCAAAACATGTAGTGGTGGGGACAATGCAGA
ACAATCCTTTGACGTGACAAGAAATAATTTTGATAGCTTCTACTTCCAAGCATTGCAAAGGAAAGCTGGAGTCCTATTTTCAGACCAAACCCTATACAATAATCCAGAAACCAAAGCAAT
TGTCAATAACTATGCTATGAACCAGGCCATGTTTTTCCTTGATTTTCAACGGGCAATGGTGAAAATGAGCTTGCTTGATGTTAAGGAAGGATCAAAAGGAGAAGTAAGAGCAGATTGCCG
TAAAGTAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTGGCTAATTTTCTTGGCGTGGTCTTATTGATGGAGTTAATAGCAGGTGGTTATAGATTTGGAGCAGATGGCCTGAGCATGAACTACTATGTTTTCAATTGCCCGTTAGCAGAG
CCAATTGTGAGGAGCACAGTGTCAAGTGCTTTGCAGTCTGATCCTACCTTAGCAGCTGCTCTTGTTAGAATGCATTTTCATGATTGCTGGATACAA
GGATGTGATGGGTCTATCCTGCTG
GACTCAACAAAGGATAACACAGCAGAGAAGGATTCTCCAGGAAATCTGAGTGTTAGAGGCTTTGAATTAATTGATGATGTAAAGGAGCAACTTGAAAACCAATGCCCTGGTGTTGTCTCC
TGTGCTGATATTGTTGCAATGGCTGCTAGAGAGGCTGTTTCTTGG
TCAGGAGGTCCAGTGTATGACATACCAAAAGGAAGAAAAGATGGAAGAAGGTCTAAAATTGAAGACACTATCAAT
TTGCCTTTCCCCACTTTTAATGCCTCTGAGCTCGTTAGAGTCTTTGGCAAACGTGGTTTCAGTGCCCAATACATGGTTGCTTTGTCTG
GGGCACATACACTGGGAGTGGCAAGGTGCTCA
TCGTTCAAAACTAGGTTGAGTGACCCTGTTGATCCAACTATGGACTCAGACTTTTCGAAGGCATTGGCCAAAACATGTAGTGGTGGGGACAATGCAGAACAATCCTTTGACGTGACAAGA
AATAATTTTGATAGCTTCTACTTCCAAGCATTGCAAAGGAAAGCTGGAGTCCTATTTTCAGACCAAACCCTATACAATAATCCAGAAACCAAAGCAATTGTCAATAACTATGCTATGAAC
CAGGCCATGTTTTTCCTTGATTTTCAACGGGCAATGGTGAAAATGAGCTTGCTTGATGTTAAGGAAGGATCAAAAGGAGAAGTAAGAGCAGATTGCCGTAAAGTAAACTAA

Retrieve as FASTA