Entry information : PtPrx06 (POPTR_0004s02240 / Potri.004G023200)
Entry ID 3084
Creation 2006-06-14 (Claudia Cosio)
Last sequence changes 2006-06-14 (Claudia Cosio)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-07 (Qiang Li)
Peroxidase information: PtPrx06 (POPTR_0004s02240 / Potri.004G023200)
Name (synonym) PtPrx06 (POPTR_0004s02240 / Potri.004G023200)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx06
start..stop
S start..stop
PtPrx05 653 0 1..327 1..327
PtPrx91 565 0 1..327 1..327
PtPrx55 554 0 1..327 1..327
MePrx108 480 2e-172 1..327 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1531389..1531610 222 N° 2 1531726..1531911 186 N° 3 1531993..1532158 166 N° 4 1532252..1532661 410
join(1531389..1531610,1531726..1531911,1531993..1532158,1532252..1532661)


exon

Literature and cross-references PtPrx06 (POPTR_0004s02240 / Potri.004G023200)
DNA ref. Phytozome 12:   Chr04 (1531389..1532661)
Omic ref. ePlant:   Potri.004G023200
Protein sequence: PtPrx06 (POPTR_0004s02240 / Potri.004G023200)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (300)
PWM (Da):   %s   35608.56 (32716.0) Transmb domain:   %s   o10-27i
PI (pH):   %s   9.64 (9.65) Peptide Signal:   %s   cut: 28 range:28-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDSLKLSSGLIFIQLVLLAFVFNSANAQLKVGFYKDTCPQAEAIVKGVMDQVLKVAPSLSGPLLRLHFHDCFVRGCDASILLNSSTGQAEKDSPPNLSLRGYQVIDRVKAALEKKCPGVVSCADILAIVARDVTVATLGPSWRVETGRRDGRVSNVSEPLTNLPPFFANISQLLTQFRSKNLSKKDLVVLSGAHTIGTSHCSSFDSRLYNFTGKGDTDPTLDSEYITRLKKICKAGDQITLVEMDPGGARTFDNRYYKLVANRRALFQSDAALLDNNYTKAYVKLQSVASDGSTFFKDFGVSMRKMGRVEVLTGKAGEIRKVCSKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATAGTTTAAAGCTTTCTTCAGGTTTAATCTTTATTCAATTGGTTTTGCTAGCATTTGTCTTTAACTCGGCAAATGCGCAATTGAAGGTAGGGTTTTACAAGGATACATGTCCACAA
GCTGAAGCTATTGTGAAAGGGGTTATGGATCAAGTGTTGAAAGTTGCTCCTAGTCTTAGTGGCCCTTTGTTGAGGTTGCACTTTCATGACTGCTTTGTTAGG
GTACGTAAGCCATTAATC
CATTTCTGATCATTTGAAATTCTGAAACAGTTTATTCTTTTTTGCTTGAATTATAGCAAAACCCTTACGATCACTAGCTAATTTTATATGTCTACAGGGTTGTGATGCGTCAATTCTTTT
GAACTCTAGTACTGGCCAAGCTGAAAAAGATTCACCTCCAAATTTAAGCCTTAGAGGATATCAAGTTATTGACAGGGTCAAGGCTGCGTTAGAAAAAAAGTGCCCTGGAGTGGTTTCCTG
TGCAGATATCTTGGCCATTGTGGCTAGGGATGTCACGGTCGCG
GTAAGAAATATCTTTCAAATTCATTAGAGAGTTTCTTTTGCAAGCAAAATGTTTGTATTTAACAAAAAATTATCCTC
TCAGACTTTGGGACCATCCTGGCGAGTTGAAACTGGAAGAAGAGATGGAAGGGTGTCTAACGTTTCAGAGCCTTTAACAAACCTGCCACCATTTTTCGCAAACATTTCTCAATTGTTAAC
ACAATTTCGTTCTAAGAACCTAAGCAAAAAGGACCTTGTAGTGCTCTCAG
GTATTTAAACATTTCAAGTTCAGTTTCTTCATAGAGATTCTTGAAACAAGAAATTGAACTTGAATAATTC
TATTTATTCTTCCTGGCACGTAGGTGCGCACACCATTGGCACTTCTCATTGCTCTTCTTTCGATTCTCGGCTTTACAACTTCACCGGAAAGGGTGACACTGATCCCACACTGGATTCAGA
ATACATAACACGGTTGAAGAAAATATGCAAGGCAGGAGATCAAATTACGCTAGTCGAAATGGATCCTGGAGGCGCCAGGACATTCGACAACAGATATTATAAACTCGTAGCTAATAGAAG
GGCACTTTTCCAGTCTGATGCAGCTCTCCTTGACAACAATTACACAAAAGCTTATGTTAAACTTCAGTCTGTTGCTAGCGATGGATCCACTTTCTTCAAAGACTTTGGTGTTTCCATGAG
AAAAATGGGAAGGGTTGAAGTTCTTACTGGTAAAGCTGGTGAAATCAGGAAAGTTTGCAGCAAAGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATAGTTTAAAGCTTTCTTCAGGTTTAATCTTTATTCAATTGGTTTTGCTAGCATTTGTCTTTAACTCGGCAAATGCGCAATTGAAGGTAGGGTTTTACAAGGATACATGTCCACAA
GCTGAAGCTATTGTGAAAGGGGTTATGGATCAAGTGTTGAAAGTTGCTCCTAGTCTTAGTGGCCCTTTGTTGAGGTTGCACTTTCATGACTGCTTTGTTAGG
GGTTGTGATGCGTCAATT
CTTTTGAACTCTAGTACTGGCCAAGCTGAAAAAGATTCACCTCCAAATTTAAGCCTTAGAGGATATCAAGTTATTGACAGGGTCAAGGCTGCGTTAGAAAAAAAGTGCCCTGGAGTGGTT
TCCTGTGCAGATATCTTGGCCATTGTGGCTAGGGATGTCACGGTCGCG
ACTTTGGGACCATCCTGGCGAGTTGAAACTGGAAGAAGAGATGGAAGGGTGTCTAACGTTTCAGAGCCTTTA
ACAAACCTGCCACCATTTTTCGCAAACATTTCTCAATTGTTAACACAATTTCGTTCTAAGAACCTAAGCAAAAAGGACCTTGTAGTGCTCTCAG
GTGCGCACACCATTGGCACTTCTCAT
TGCTCTTCTTTCGATTCTCGGCTTTACAACTTCACCGGAAAGGGTGACACTGATCCCACACTGGATTCAGAATACATAACACGGTTGAAGAAAATATGCAAGGCAGGAGATCAAATTACG
CTAGTCGAAATGGATCCTGGAGGCGCCAGGACATTCGACAACAGATATTATAAACTCGTAGCTAATAGAAGGGCACTTTTCCAGTCTGATGCAGCTCTCCTTGACAACAATTACACAAAA
GCTTATGTTAAACTTCAGTCTGTTGCTAGCGATGGATCCACTTTCTTCAAAGACTTTGGTGTTTCCATGAGAAAAATGGGAAGGGTTGAAGTTCTTACTGGTAAAGCTGGTGAAATCAGG
AAAGTTTGCAGCAAAGTTAATTAA

Retrieve as FASTA