Entry information : PtPrx33 (POPTR_0001s04820)
Entry ID 3102
Creation 2010-01-18 (Christophe Dunand)
Last sequence changes 2010-06-21 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx33 (POPTR_0001s04820)
Name (synonym) PtPrx33 (POPTR_0001s04820)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx33
start..stop
S start..stop
PatrPrx24 663 0 1..343 1..343
PtPrx22 662 0 1..343 1..343
PnPrx02 659 0 1..343 1..343
PnPrx01 658 0 1..343 1..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3698001..3698213 213 N° 2 3697721..3697912 192 N° 3 3697316..3697484 169 N° 4 3696768..3697225 458
complement(join(3696768..3697225,3697316..3697484,3697721..3697912,3698001..3698 213))


exon

Literature and cross-references PtPrx33 (POPTR_0001s04820)
DNA ref. Phytozome 12:   scaffold_1 (3698213..3696768)
Omic ref. ePlant:   Potri.001G011000
Protein sequence: PtPrx33 (POPTR_0001s04820)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343 (321)
PWM (Da):   %s   36410.94 (34094.6) Transmb domain:   %s   i7-26o
PI (pH):   %s   4.22 (4.12) Peptide Signal:   %s   cut: 23 range:23-343
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHLSKAIVATFFFVVLLGGTLAHGQLTPTFYDQTCPNVSSIIRNVITETLVSDPRIAASLIRLHFHDCFVNGCDGSLLLDNTDTIVSEKEAGGNNNSARGFEVVDTMKALLESACPATVSCADILTIAAEESVVLAGGPNWTVPLGRRDSTTASRDAANAFLPAPSLTLDQLRESFTNVSLNNNSDLVALSGAHTFGRAKCSTFDFRLFDFNRTGAPDPSMDTTLLAALQELCPQGGNGSVITDLDLTTPDAFDSNYYSNLQGNRGLLQTDQELFSTPGADDVIALVNAFSANQTAFFESFVESMIRMGNLSPLTGTEGEIRLNCRVVNANLAGPDSMLVSSI

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (chromo 1, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTTTCTAAGGCTATAGTTGCAACTTTTTTCTTTGTAGTTTTGCTTGGAGGAACATTGGCTCATGGCCAGCTTACTCCAACATTTTATGACCAGACATGTCCAAATGTGAGCAGC
ATTATCCGTAATGTCATTACGGAGACATTGGTATCCGATCCTCGGATTGCAGCCAGCCTCATCAGGCTCCACTTCCATGACTGCTTTGTTAAT
GTAATTGCTTTGAAACATCTTATATTG
CTTAATTATATTAAACCGTCTATCTAAGTTGTGATTCTCAAGTTTTTTATTTTATTTTCAGGGCTGTGATGGTTCGCTTTTGTTGGACAATACTGATACTATAGTGAGCGAAAAGGAAGC
CGGAGGGAACAACAACTCTGCAAGAGGTTTTGAAGTTGTTGATACAATGAAGGCTTTGTTGGAGAGTGCCTGTCCTGCTACTGTTTCCTGTGCTGATATACTCACTATTGCAGCTGAAGA
ATCTGTTGTCTTG
GTATCTTAAAATGATCCCTCAACCCCCCCAAAATATAAAATAGATCTCTTGTTGTCTAATTCTAGTCAAAGAACGTAGAACACAAATATCATAGTTTATCATAATTG
AATGAAAGAAAGAAGCTGAGATTTACTTAATTTTTTACATGACTTTATGACGGTTTGGACAGAAGGAGTTAAGATAGAAATACGTTAAGAGTTGAAAAGTAGTAATCCCCTAACTATGCA
TGGTTGCAGGCAGGAGGTCCAAATTGGACAGTTCCATTAGGAAGAAGAGATAGTACAACAGCAAGCCGAGATGCAGCAAATGCTTTCCTTCCGGCCCCTTCTCTCACCCTTGATCAACTC
AGAGAGAGCTTCACTAATGTCAGCCTTAATAATAATAGTGATTTGGTAGCTCTATCTG
GTAAGTATTGTTTGTCAGGCTCGATTCTAAACTGTAAAACTCTGTTATAATTGATTCTCCTT
TGATGTAATTTCCTTTTTATCTTCTCAGGTGCTCACACATTTGGAAGGGCAAAATGTTCTACATTCGACTTCCGATTGTTTGATTTCAACAGAACCGGTGCTCCTGACCCATCAATGGAC
ACAACTCTTCTAGCAGCTCTTCAGGAATTATGTCCCCAAGGTGGAAATGGGAGTGTGATAACAGATCTTGATCTCACAACACCTGATGCCTTTGACAGTAACTACTACTCCAATCTGCAA
GGTAACCGAGGCCTGCTTCAGACTGATCAAGAACTGTTTTCAACTCCGGGGGCAGATGATGTCATTGCACTTGTTAACGCTTTCAGTGCTAATCAAACAGCTTTCTTTGAAAGCTTTGTG
GAGTCCATGATAAGAATGGGAAATCTCAGCCCTCTGACAGGAACTGAAGGAGAGATCAGATTGAACTGCAGGGTAGTCAATGCAAACTTGGCTGGGCCAGATAGCATGCTTGTTAGCTCA
ATTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTTTCTAAGGCTATAGTTGCAACTTTTTTCTTTGTAGTTTTGCTTGGAGGAACATTGGCTCATGGCCAGCTTACTCCAACATTTTATGACCAGACATGTCCAAATGTGAGCAGC
ATTATCCGTAATGTCATTACGGAGACATTGGTATCCGATCCTCGGATTGCAGCCAGCCTCATCAGGCTCCACTTCCATGACTGCTTTGTTAAT
GGCTGTGATGGTTCGCTTTTGTTGGAC
AATACTGATACTATAGTGAGCGAAAAGGAAGCCGGAGGGAACAACAACTCTGCAAGAGGTTTTGAAGTTGTTGATACAATGAAGGCTTTGTTGGAGAGTGCCTGTCCTGCTACTGTTTCC
TGTGCTGATATACTCACTATTGCAGCTGAAGAATCTGTTGTCTTG
GCAGGAGGTCCAAATTGGACAGTTCCATTAGGAAGAAGAGATAGTACAACAGCAAGCCGAGATGCAGCAAATGCT
TTCCTTCCGGCCCCTTCTCTCACCCTTGATCAACTCAGAGAGAGCTTCACTAATGTCAGCCTTAATAATAATAGTGATTTGGTAGCTCTATCTG
GTGCTCACACATTTGGAAGGGCAAAA
TGTTCTACATTCGACTTCCGATTGTTTGATTTCAACAGAACCGGTGCTCCTGACCCATCAATGGACACAACTCTTCTAGCAGCTCTTCAGGAATTATGTCCCCAAGGTGGAAATGGGAGT
GTGATAACAGATCTTGATCTCACAACACCTGATGCCTTTGACAGTAACTACTACTCCAATCTGCAAGGTAACCGAGGCCTGCTTCAGACTGATCAAGAACTGTTTTCAACTCCGGGGGCA
GATGATGTCATTGCACTTGTTAACGCTTTCAGTGCTAATCAAACAGCTTTCTTTGAAAGCTTTGTGGAGTCCATGATAAGAATGGGAAATCTCAGCCCTCTGACAGGAACTGAAGGAGAG
ATCAGATTGAACTGCAGGGTAGTCAATGCAAACTTGGCTGGGCCAGATAGCATGCTTGTTAGCTCAATTTGA

Retrieve as FASTA