Entry information : PtPrx30 (Potri.007G019300.1 / POPTR_0007s13420)
Entry ID 3108
Creation 2006-07-21 (Claudia Cosio)
Last sequence changes 2006-07-21 (Claudia Cosio)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-09-24 (Christophe Dunand)
Peroxidase information: PtPrx30 (Potri.007G019300.1 / POPTR_0007s13420)
Name (synonym) PtPrx30 (Potri.007G019300.1 / POPTR_0007s13420)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type Flowers
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx30
start..stop
S start..stop
PbPrx02 638 0 1..333 1..333
PtPrx45 635 0 1..333 1..333
CclPrx35 609 0 7..332 5..330
RcPrx17 608 0 1..333 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13522308..13522538 231 N° 2 13522634..13522825 192 N° 3 13522912..13523077 166 N° 4 13523160..13523572 413
join(13522308..13522538,13522634..13522825,13522912..13523077,13523160..13523572 )


exon

Literature and cross-references PtPrx30 (Potri.007G019300.1 / POPTR_0007s13420)
Literature REFERENCE 1 Unneberg,P., Bhalerao,R.R., Jansson,S. and Sterky,F. The poplar tree transcriptome: Analysis of expressed sequence tags from multiple libraries Unpublished (2002).
REFERENCE 2 DOE joint genome institute.
DNA ref. Phytozome 12:   scaffold_7 (13522308..13523572)
EST ref. GenBank:   BU880754 [5' end]   BU868720 [3' end]
Omic ref. ePlant:   Potri.007G019300
Protein sequence: PtPrx30 (Potri.007G019300.1 / POPTR_0007s13420)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (309)
PWM (Da):   %s   36165.43 (33677.1) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.15 (9.44) Peptide Signal:   %s   cut: 25 range:25-333
Sequence 374
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAQSISIVLVLALALLAFAPLCFCGKTSGGYLYPQFYDRSCPKAQEIVNSIVAKAVAKEARMAASLLRLHFHDCFVKGCDASILLDSSGSIITEKSSNPNRNSVRGFEVIDEIKSALEKECPKTVSCADIMALAARDSTVIAGGPSWEVPLGRRDSRGASLSGSNNNIPAPNNTFQTILTKFKLQGLDVVDLVALSGSHTIGNARCTSFRQRLYNQSGNGQPDSTLQQSFAAQLRTRCPRSGGDQNLFFLDFVSPRKFDNSYFNNILASKGLLSSDQVLLTKNEASMELVKKYAENNELFFEQFAKSMVKMGNISPLTGSRGEIRKSCRKINA

Retrieve as FASTA  
Remarks From genomic DNA (3 introns) and 2 ESTs (BU868720, BU880754). Splicing predicted by the PeroxiBase team with FGeneSH.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTCAGTCTATTAGCATTGTCTTAGTTCTTGCTCTTGCTCTCCTTGCCTTTGCCCCTCTTTGCTTTTGTGGCAAGACAAGTGGTGGCTACCTCTACCCACAGTTTTACGATAGGTCAT
GCCCGAAAGCTCAAGAAATAGTAAACTCCATTGTAGCCAAGGCAGTTGCTAAAGAAGCTCGCATGGCAGCCTCATTACTTAGGCTCCATTTTCATGACTGTTTTGTCAAG
GTCTATAACT
GATTACTTACTATATGTAACTCTGCTCATCACTAGCTCTTCTACCATCATGACTACTATAATTTAAACTGTTGTTAAAATTGCAGGGCTGCGATGCATCAATATTGCTAGACAGCAGTGG
AAGCATAATAACTGAGAAGAGTTCAAATCCAAACAGAAACTCAGTTCGAGGATTTGAAGTGATCGACGAGATTAAATCTGCACTAGAAAAGGAGTGTCCTAAAACTGTTTCCTGTGCTGA
TATCATGGCTTTGGCTGCAAGAGATTCTACTGTTATT
GTAAGTGTTACATAAGAATTAGTCTTGTAATACTTTTTGTTAACGAAAACTCCAGAGCTAACCACAATTTGTTAATGCACACA
CAGGCTGGAGGTCCTAGCTGGGAAGTTCCATTGGGAAGAAGGGACTCTAGAGGTGCAAGTTTGAGTGGTTCTAACAACAATATTCCTGCTCCAAACAACACATTTCAAACAATTCTTACC
AAGTTCAAGTTACAAGGCCTTGATGTTGTTGATCTTGTAGCACTATCTG
GTAAATTAACTCAACCAATGCCCTTCTTTGAGCTTCAGCAAACTATTAATAAGGTCCTTAAGTTTCGAAAA
AATTTGTTCAGGGAGCCACACAATTGGAAATGCTCGGTGCACCAGCTTCAGGCAGAGGCTGTACAACCAGTCAGGAAATGGGCAGCCTGATTCCACTCTTCAACAATCATTTGCTGCCCA
GTTGCGCACTAGGTGCCCCAGATCAGGAGGTGACCAGAACCTGTTTTTCTTGGACTTTGTAAGTCCAAGAAAGTTCGACAACAGCTACTTCAACAACATATTGGCTTCAAAGGGACTGCT
GAGCTCTGACCAAGTTCTCCTGACAAAGAATGAAGCATCGATGGAATTGGTCAAGAAATATGCCGAGAACAATGAGCTTTTCTTTGAGCAATTTGCCAAGTCCATGGTTAAGATGGGAAA
TATCTCTCCGTTGACAGGTTCCAGGGGAGAGATTAGAAAGAGTTGCAGGAAGATTAATGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTCAGTCTATTAGCATTGTCTTAGTTCTTGCTCTTGCTCTCCTTGCCTTTGCCCCTCTTTGCTTTTGTGGCAAGACAAGTGGTGGCTACCTCTACCCACAGTTTTACGATAGGTCAT
GCCCGAAAGCTCAAGAAATAGTAAACTCCATTGTAGCCAAGGCAGTTGCTAAAGAAGCTCGCATGGCAGCCTCATTACTTAGGCTCCATTTTCATGACTGTTTTGTCAAG
GGCTGCGATG
CATCAATATTGCTAGACAGCAGTGGAAGCATAATAACTGAGAAGAGTTCAAATCCAAACAGAAACTCAGTTCGAGGATTTGAAGTGATCGACGAGATTAAATCTGCACTAGAAAAGGAGT
GTCCTAAAACTGTTTCCTGTGCTGATATCATGGCTTTGGCTGCAAGAGATTCTACTGTTATT
GCTGGAGGTCCTAGCTGGGAAGTTCCATTGGGAAGAAGGGACTCTAGAGGTGCAAGTT
TGAGTGGTTCTAACAACAATATTCCTGCTCCAAACAACACATTTCAAACAATTCTTACCAAGTTCAAGTTACAAGGCCTTGATGTTGTTGATCTTGTAGCACTATCTG
GGAGCCACACAA
TTGGAAATGCTCGGTGCACCAGCTTCAGGCAGAGGCTGTACAACCAGTCAGGAAATGGGCAGCCTGATTCCACTCTTCAACAATCATTTGCTGCCCAGTTGCGCACTAGGTGCCCCAGAT
CAGGAGGTGACCAGAACCTGTTTTTCTTGGACTTTGTAAGTCCAAGAAAGTTCGACAACAGCTACTTCAACAACATATTGGCTTCAAAGGGACTGCTGAGCTCTGACCAAGTTCTCCTGA
CAAAGAATGAAGCATCGATGGAATTGGTCAAGAAATATGCCGAGAACAATGAGCTTTTCTTTGAGCAATTTGCCAAGTCCATGGTTAAGATGGGAAATATCTCTCCGTTGACAGGTTCCA
GGGGAGAGATTAGAAAGAGTTGCAGGAAGATTAATGCTTGA

Retrieve as FASTA