Entry information : PtPrx31 (POPTR_0007s07330 / Potri.007G074700)
Entry ID 3109
Creation 2008-08-18 (Christophe Dunand)
Last sequence changes 2010-06-17 (Marie Brette (Scipio))
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx31 (POPTR_0007s07330 / Potri.007G074700)
Name (synonym) PtPrx31 (POPTR_0007s07330 / Potri.007G074700)
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx31
start..stop
S start..stop
NnPrx46 532 0 4..330 12..338
CclPrx34 527 0 12..330 16..329
CsPrx42 525 0 12..330 16..329
VvPrx09 498 4e-179 16..331 21..336
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5685527..5685748 222 N° 2 5685833..5686027 195 N° 3 5686142..5686720 579  
join(5685527..5685748,5685833..5686027,5686142..5686720)


exon

Literature and cross-references PtPrx31 (POPTR_0007s07330 / Potri.007G074700)
Literature DOE joint genome institute.
DNA ref. Phytozome 12:   scaffold_7 (5685527..5686720)
Omic ref. ePlant:   Potri.007G074700
Protein sequence: PtPrx31 (POPTR_0007s07330 / Potri.007G074700)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (305)
PWM (Da):   %s   36632.51 (33775.0)  
PI (pH):   %s   7.36 (7.06) Peptide Signal:   %s   cut: 27 range:27-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDRVQLCLTPIFFLVLVPCVARGTNALGLSYDFYNKTCPNVEKIIHNVVSQKLLEAPVTAAGALRIFFHDCFVEGCDASVLIASRESNKAERDAEINLSLPGDGYDVFFRAKRALELQCPGFVSCADVMAIATRDLVNLVGGPRWEVKKGRRDGLISKASRVDGNLPQVNQTIPQLISLFKSKGLSTMDMVALSGGHTIGFSHCKEFMPRIYGYNSTFDIDPTMNQEYARTLRSPCPQRHLDPTVVALNDVTTPFIFDNAYYHNLKKGLGLLASDQMLVLDPLTRGYVDMMAADQQLFFNYFVESMIKLGQVGVKTGSDGEIRRRCDSFNN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATAGAGTTCAATTGTGTCTTACCCCAATTTTCTTTCTGGTTTTGGTTCCTTGCGTGGCTAGAGGAACAAATGCACTAGGCCTTAGCTACGATTTCTACAATAAGACTTGTCCCAAT
GTAGAGAAAATCATCCACAATGTGGTTTCTCAAAAGCTTTTGGAAGCTCCTGTCACCGCTGCTGGTGCTCTTCGCATCTTCTTCCATGACTGCTTTGTTGAG
GTACAAAGACTGCAATTA
CAATGAACATAAAAACCATCACGGCCATTTCACTGAAAGTTCTCTCTTTTTCTCCATCTTTTGAAGGGATGTGATGCGTCAGTCTTAATAGCATCAAGGGAGAGCAACAAGGCAGAGAGG
GATGCAGAAATAAATCTTTCTTTGCCAGGAGATGGCTACGATGTCTTCTTCCGAGCCAAGAGAGCTCTAGAGTTGCAATGCCCTGGCTTTGTCTCTTGTGCTGATGTTATGGCCATTGCC
ACTAGAGACTTGGTTAACTTG
GTCTTGTCTCAAACTTGCCTTGAAACATTTTTAATTCAACATTTGTTAGATCACAAGTATTGAAATCTGAAAGAAGAGTAATAGTTTACAACGTACAAT
GCATGTTCTTTTCAGGTGGGAGGGCCAAGGTGGGAAGTGAAGAAGGGGAGAAGAGATGGGCTAATCTCCAAGGCCTCAAGGGTGGACGGCAACCTTCCTCAGGTGAACCAAACAATCCCT
CAACTAATCTCACTTTTCAAATCCAAAGGTCTATCCACCATGGACATGGTGGCCTTATCAGGCGGACACACCATAGGTTTCTCACATTGCAAGGAATTCATGCCAAGAATCTATGGCTAC
AACAGCACATTTGACATAGACCCGACAATGAACCAGGAATATGCAAGAACCCTTCGGAGTCCTTGTCCTCAGAGACATCTTGATCCAACTGTGGTTGCCCTTAATGATGTAACTACACCA
TTTATTTTTGACAATGCTTATTACCACAACCTTAAAAAGGGTCTTGGGTTGCTAGCAAGTGACCAGATGTTGGTTTTGGACCCCTTAACTCGAGGTTATGTGGATATGATGGCTGCTGAT
CAACAACTTTTTTTCAATTACTTTGTTGAGTCCATGATAAAGCTAGGCCAAGTTGGAGTCAAGACGGGGAGTGATGGTGAGATTAGAAGACGTTGTGACTCCTTCAATAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATAGAGTTCAATTGTGTCTTACCCCAATTTTCTTTCTGGTTTTGGTTCCTTGCGTGGCTAGAGGAACAAATGCACTAGGCCTTAGCTACGATTTCTACAATAAGACTTGTCCCAAT
GTAGAGAAAATCATCCACAATGTGGTTTCTCAAAAGCTTTTGGAAGCTCCTGTCACCGCTGCTGGTGCTCTTCGCATCTTCTTCCATGACTGCTTTGTTGAG
GGATGTGATGCGTCAGTC
TTAATAGCATCAAGGGAGAGCAACAAGGCAGAGAGGGATGCAGAAATAAATCTTTCTTTGCCAGGAGATGGCTACGATGTCTTCTTCCGAGCCAAGAGAGCTCTAGAGTTGCAATGCCCT
GGCTTTGTCTCTTGTGCTGATGTTATGGCCATTGCCACTAGAGACTTGGTTAACTTG
GTGGGAGGGCCAAGGTGGGAAGTGAAGAAGGGGAGAAGAGATGGGCTAATCTCCAAGGCCTCA
AGGGTGGACGGCAACCTTCCTCAGGTGAACCAAACAATCCCTCAACTAATCTCACTTTTCAAATCCAAAGGTCTATCCACCATGGACATGGTGGCCTTATCAGGCGGACACACCATAGGT
TTCTCACATTGCAAGGAATTCATGCCAAGAATCTATGGCTACAACAGCACATTTGACATAGACCCGACAATGAACCAGGAATATGCAAGAACCCTTCGGAGTCCTTGTCCTCAGAGACAT
CTTGATCCAACTGTGGTTGCCCTTAATGATGTAACTACACCATTTATTTTTGACAATGCTTATTACCACAACCTTAAAAAGGGTCTTGGGTTGCTAGCAAGTGACCAGATGTTGGTTTTG
GACCCCTTAACTCGAGGTTATGTGGATATGATGGCTGCTGATCAACAACTTTTTTTCAATTACTTTGTTGAGTCCATGATAAAGCTAGGCCAAGTTGGAGTCAAGACGGGGAGTGATGGT
GAGATTAGAAGACGTTGTGACTCCTTCAATAATTAA

Retrieve as FASTA