Entry information : SmPrx[P]53b_1
Entry ID 3131
Creation 2010-01-22 (Christophe Dunand)
Last sequence changes 2011-02-08 (Toky Ramarohetra)
Sequence status theoretical translation / pseudogene
Reviewer Toky Ramarohetra
Last annotation changes 2011-02-17 (Toky Ramarohetra)
Peroxidase information: SmPrx[P]53b_1
Name SmPrx[P]53b_1
Class Class III peroxidase     [Orthogroup: Prx006]*
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue types Leaves
Stems
Inducers Insect damage (Spodoptera exigua, Meloidogyne, Aphib)
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx[P]53b_1
start..stop
S start..stop
SmPrx[P]54a_16 508 0 1..251 1..251
SmPrx[P]53a_16 508 0 1..251 1..251
SmPrx52-2_1 509 0 1..251 96..346
SmPrx52-1_16 509 0 1..251 96..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2614491..2614845 355 N° 2 2614922..2615322 401  
join(2614491..2614845,2614922..2615322)


exon

Literature and cross-references SmPrx[P]53b_1
DNA ref. Phytozome 12:   scaffold_1 (2614491..2615322)
Protein sequence: SmPrx[P]53b_1
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   251
PWM (Da):   %s   26973.86  
PI (pH):   %s   7.8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCDASILLDSKGSIKSERDSDKNFGIRRLDFIDRIKSMLEAACPGVVSCADIIVLVARESIVFTGGPTIPVLTGRRDGTAASNAAADRLLPPATVSVDNFISLFASKGLSLDESVAIIGAHTIGVGHCVNIVNRLYPNQDSKIGLLFASRLRVQCPTANPRMLNNITVINNDMTNLVFDNQYFRDLMNGQGLFTIDSELALDSRTSPVVARFSTNQQLFLDTFSSAFVKLTSSNVLTGQSGQVRKYCHSVN

Retrieve as FASTA  
Remarks Partial sequence from genomic (intron 3). No EST. First exon is missing
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGTTGCGACGCGTCCATCTTGCTCGACTCGAAAGGTTCCATCAAAAGCGAGAGAGACTCGGACAAGAACTTTGGCATCCGCCGCTTGGATTTCATCGACAGGATCAAGTCGATGCTGGAG
GCTGCCTGTCCGGGAGTCGTCTCGTGCGCGGACATCATCGTTCTGGTGGCCAGAGAATCCATCGTCTTCACCGGAGGCCCGACAATCCCCGTGCTCACAGGAAGAAGAGATGGCACAGCC
GCTTCCAACGCCGCAGCCGACAGGCTGTTGCCTCCAGCAACCGTAAGCGTCGACAACTTCATCAGCCTCTTCGCATCCAAGGGCCTCTCTCTCGACGAAAGCGTTGCAATCATCG
GTACG
TTTCAAGGCTTTTCTTTCCAGCAAACTTTCCAAGGACGATTGATCCGAACTTCTGTACTTTTGCATTCCAGGAGCTCACACAATTGGAGTTGGGCACTGCGTCAACATTGTGAATCGGCT
CTATCCAAACCAGGACAGTAAGATCGGCCTCCTGTTCGCGAGCCGGCTGAGAGTCCAGTGCCCGACGGCCAATCCCCGGATGCTCAACAACATTACAGTGATCAACAACGATATGACCAA
CCTCGTGTTTGACAACCAGTACTTCCGGGACCTTATGAACGGGCAGGGGCTCTTCACCATCGATTCGGAGCTTGCGCTGGACAGCCGCACGTCGCCAGTGGTGGCGCGCTTCTCCACGAA
CCAGCAGCTCTTCCTCGACACATTCTCTTCGGCTTTCGTCAAGCTCACGTCCAGCAATGTCTTGACGGGACAGAGTGGACAGGTTCGAAAGTACTGCCACTCGGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGTTGCGACGCGTCCATCTTGCTCGACTCGAAAGGTTCCATCAAAAGCGAGAGAGACTCGGACAAGAACTTTGGCATCCGCCGCTTGGATTTCATCGACAGGATCAAGTCGATGCTGGAG
GCTGCCTGTCCGGGAGTCGTCTCGTGCGCGGACATCATCGTTCTGGTGGCCAGAGAATCCATCGTCTTCACCGGAGGCCCGACAATCCCCGTGCTCACAGGAAGAAGAGATGGCACAGCC
GCTTCCAACGCCGCAGCCGACAGGCTGTTGCCTCCAGCAACCGTAAGCGTCGACAACTTCATCAGCCTCTTCGCATCCAAGGGCCTCTCTCTCGACGAAAGCGTTGCAATCATCG
GAGCT
CACACAATTGGAGTTGGGCACTGCGTCAACATTGTGAATCGGCTCTATCCAAACCAGGACAGTAAGATCGGCCTCCTGTTCGCGAGCCGGCTGAGAGTCCAGTGCCCGACGGCCAATCCC
CGGATGCTCAACAACATTACAGTGATCAACAACGATATGACCAACCTCGTGTTTGACAACCAGTACTTCCGGGACCTTATGAACGGGCAGGGGCTCTTCACCATCGATTCGGAGCTTGCG
CTGGACAGCCGCACGTCGCCAGTGGTGGCGCGCTTCTCCACGAACCAGCAGCTCTTCCTCGACACATTCTCTTCGGCTTTCGTCAAGCTCACGTCCAGCAATGTCTTGACGGGACAGAGT
GGACAGGTTCGAAAGTACTGCCACTCGGTGAACTAG

Retrieve as FASTA