Entry information : PtPrx45 (Potri.005G118700.1 / POPTR_0005s12070)
Entry ID 3135
Creation 2006-06-13 (Claudia Cosio)
Last sequence changes 2010-06-22 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-09-24 (Christophe Dunand)
Peroxidase information: PtPrx45 (Potri.005G118700.1 / POPTR_0005s12070)
Name (synonym) PtPrx45 (Potri.005G118700.1 / POPTR_0005s12070)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx45
start..stop
S start..stop
PbPrx02 679 0 1..333 1..333
PtPrx30 611 0 1..333 1..333
RcPrx17 599 0 1..333 1..331
NnPrx50 593 0 1..333 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8865034..8865264 231 N° 2 8864752..8864943 192 N° 3 8864498..8864663 166 N° 4 8864005..8864417 413
complement(join(8864005..8864417,8864498..8864663,8864752..8864943,8865034..8865 264))


exon

Literature and cross-references PtPrx45 (Potri.005G118700.1 / POPTR_0005s12070)
DNA ref. Phytozome 12:   scaffold_5 (8865264..8864005)
Omic ref. ePlant:   Potri.005G118700
Protein sequence: PtPrx45 (Potri.005G118700.1 / POPTR_0005s12070)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (309)
PWM (Da):   %s   36283.56 (33721.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.69 (9.90) Peptide Signal:   %s   cut: 25 range:25-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPQLISVVLVLGLAFLAFSPICFCGKTAGGYLYPQFYDRSCPKAREIVNSIVAKAVAKEARMAASLLRLHFHDCFVKGCDASILLDSTGSIISEKGSNPNRNSARGFEVIDEIKSALEKECPKTVSCADIMALSARDSTVLTGGPSWEVPLGRRDSRSASLSGSNNNIPAPNNTFQTILTKFKLQGLNVVDLVALSGSHTIGNARCTSFRQRLYNQSGNGKPDYSLQQSLAAQLRNRCPRSGGDQNLFFLDFASPKKFDNSYFKNILASKGLLNSDQVLLTKNEASMELVKKYAESNELFFEQFSKSMVKMGNISPLTGSRGEIRKSCRKINS

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCAGCTCATTAGCGTTGTCTTGGTTCTTGGTCTTGCTTTCCTTGCCTTTTCTCCGATTTGTTTTTGTGGCAAGACAGCTGGTGGCTACCTCTATCCACAGTTTTACGATAGGTCA
TGCCCAAAAGCTCGAGAAATAGTCAACTCCATTGTAGCCAAGGCAGTTGCTAAAGAAGCTCGTATGGCAGCCTCATTACTTAGGCTCCATTTTCATGACTGCTTTGTCAAG
GTCTATAAC
TGATTACTATATATAACTCTCATCACTTGCTCTTCTACTATCATGAATAAAATGATTTACATTATTTTGTTAAAATCCCAGGGCTGTGACGCATCAATATTGCTAGACAGCACCGGAAGC
ATAATAAGTGAGAAGGGGTCAAATCCGAATAGAAACTCCGCTCGAGGATTTGAAGTAATTGACGAGATTAAATCTGCACTAGAGAAGGAGTGTCCTAAAACAGTTTCCTGTGCTGATATC
ATGGCTTTGTCTGCAAGAGACTCTACCGTTCTT
GTAAGTGTTACATGTTTGTCCTGTAATGAAATTGAACCAACTTTTCTAGCCAAAATTCCAGAGCTGATCCTTTTGTTTATGTATACA
GACTGGCGGTCCTAGCTGGGAAGTTCCATTGGGAAGAAGGGACTCTAGAAGTGCAAGCTTGAGTGGTTCGAATAACAATATTCCTGCTCCAAACAACACATTTCAAACAATTCTTACCAA
GTTCAAGTTACAAGGCCTTAATGTTGTTGATCTTGTTGCGCTATCTG
GTAAGTTTACTCGACTATCCCCTTCTCTGAGTTTCCGCGAACTATGAATATGGTCCTTAGTTTTGAAAAATTT
TGTTCAGGGAGCCACACAATTGGAAATGCTCGGTGCACCAGCTTCAGGCAGAGGCTGTACAACCAGTCAGGAAATGGGAAGCCTGACTACTCTCTTCAACAATCGCTTGCTGCCCAATTG
CGCAACCGGTGCCCCAGATCAGGAGGTGACCAGAACCTGTTTTTCTTGGACTTCGCAAGTCCAAAAAAGTTCGACAACAGTTACTTCAAGAACATATTGGCTTCAAAAGGACTGTTGAAC
TCTGACCAAGTTCTCCTGACAAAGAATGAAGCATCAATGGAATTGGTCAAGAAATATGCTGAGAGCAATGAGCTTTTCTTTGAGCAATTTTCCAAGTCCATGGTTAAGATGGGAAACATC
TCTCCATTGACAGGTTCCAGGGGAGAGATTAGAAAGAGTTGCAGGAAGATTAATTCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCAGCTCATTAGCGTTGTCTTGGTTCTTGGTCTTGCTTTCCTTGCCTTTTCTCCGATTTGTTTTTGTGGCAAGACAGCTGGTGGCTACCTCTATCCACAGTTTTACGATAGGTCA
TGCCCAAAAGCTCGAGAAATAGTCAACTCCATTGTAGCCAAGGCAGTTGCTAAAGAAGCTCGTATGGCAGCCTCATTACTTAGGCTCCATTTTCATGACTGCTTTGTCAAG
GGCTGTGAC
GCATCAATATTGCTAGACAGCACCGGAAGCATAATAAGTGAGAAGGGGTCAAATCCGAATAGAAACTCCGCTCGAGGATTTGAAGTAATTGACGAGATTAAATCTGCACTAGAGAAGGAG
TGTCCTAAAACAGTTTCCTGTGCTGATATCATGGCTTTGTCTGCAAGAGACTCTACCGTTCTT
ACTGGCGGTCCTAGCTGGGAAGTTCCATTGGGAAGAAGGGACTCTAGAAGTGCAAGC
TTGAGTGGTTCGAATAACAATATTCCTGCTCCAAACAACACATTTCAAACAATTCTTACCAAGTTCAAGTTACAAGGCCTTAATGTTGTTGATCTTGTTGCGCTATCTG
GGAGCCACACA
ATTGGAAATGCTCGGTGCACCAGCTTCAGGCAGAGGCTGTACAACCAGTCAGGAAATGGGAAGCCTGACTACTCTCTTCAACAATCGCTTGCTGCCCAATTGCGCAACCGGTGCCCCAGA
TCAGGAGGTGACCAGAACCTGTTTTTCTTGGACTTCGCAAGTCCAAAAAAGTTCGACAACAGTTACTTCAAGAACATATTGGCTTCAAAAGGACTGTTGAACTCTGACCAAGTTCTCCTG
ACAAAGAATGAAGCATCAATGGAATTGGTCAAGAAATATGCTGAGAGCAATGAGCTTTTCTTTGAGCAATTTTCCAAGTCCATGGTTAAGATGGGAAACATCTCTCCATTGACAGGTTCC
AGGGGAGAGATTAGAAAGAGTTGCAGGAAGATTAATTCTTGA

Retrieve as FASTA