Entry information : PtPrx55 (POPTR_0019s09150 / Potri.019G063200)
Entry ID 3145
Creation 2006-05-31 (Claudia Cosio)
Last sequence changes 2010-07-08 (Marie Brette (Scipio))
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx55 (POPTR_0019s09150 / Potri.019G063200)
Name (synonym) PtPrx55 (POPTR_0019s09150 / Potri.019G063200)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx55
start..stop
S start..stop
PtPrx91 647 0 1..327 1..327
PtPrx06 554 0 1..327 1..327
PtPrx05 547 0 1..327 1..327
MePrx97 503 0 1..327 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10702114..10702335 222 N° 2 10701798..10701983 186 N° 3 10701538..10701703 166 N° 4 10701031..10701440 410
complement(join(10701031..10701440,10701538..10701703,10701798..10701983,1070211 4..10702335))


exon

Literature and cross-references PtPrx55 (POPTR_0019s09150 / Potri.019G063200)
DNA ref. Phytozome 12:   scaffold_19 (10702335..10701031)
mRNA ref. JGI transcript:   743906
Omic ref. ePlant:   Potri.019G063200
Protein sequence: PtPrx55 (POPTR_0019s09150 / Potri.019G063200)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (300)
PWM (Da):   %s   35601.17 (32708.6) Transmb domain:   %s   o10-27i
PI (pH):   %s   8.63 (8.56) Peptide Signal:   %s   cut: 28 range:28-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSKLSPCLIFLQVVFLVLVFNSANAQLRVGFYKDTCPKAEAIVEEVMHQVMKVAPSLSGPLLRMHFHDCFVRGCDGSVLLNSSTGQAEKDSPPNLSLRGYQIIDRVKTALEKECPGVVSCADIMAIVARDVTVATMGPFWEVETGRRDGRVSNILEPLTNLPPFFANISQLISMFRSKGLSVKDLVVLSGGHTIGTSHCSSFSSRLYNSTGKDGTDPTLDSEYIEKLKSRCKVGDQTTLVEMDPGSVRTFDNSYYTLVAKRRGLFQSDAALLDNSETKAYVKLQSAATHRPTFFKDFGVSMINMGRVGVLTGKAGEIRKVCSKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 19, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGCTCAAAGCTTTCCCCATGTCTAATCTTTCTTCAGGTCGTTTTCTTGGTGTTGGTCTTTAACTCGGCAAATGCGCAGTTGAGGGTAGGGTTTTACAAGGATACATGTCCAAAA
GCTGAGGCTATTGTGGAAGAGGTTATGCATCAAGTGATGAAAGTAGCTCCTAGCCTTAGTGGTCCTTTGTTGAGGATGCACTTTCATGACTGCTTTGTGAGG
GTATGTGAGCCTTTAATC
CATCTCTGATCATTTGAAAATCCTGAAACAGTTTTAAGCTCTCTTTTTTTCTTGCTTGAATTCATGAACAATGCTTAATTATGATGACTGGCTAATTATGTATTTTCTACAGGGCTGTGA
TGGCTCGGTGCTTTTGAACTCTAGCACTGGCCAAGCTGAAAAGGATTCACCTCCGAACTTAAGCCTTAGAGGATATCAAATTATTGACAGAGTCAAGACTGCATTAGAAAAGGAGTGTCC
TGGAGTAGTTTCCTGTGCGGACATCATGGCCATTGTGGCTAGGGATGTCACGGTTGCG
GTAAGAAATTTCTTTCAAGATAATTTCTTTTGTAAGAAAAATCTTAAGGAACAGAGAATGGT
TTTAATTGATAATAATTTATCCTATCTATCAGACTATGGGACCTTTCTGGGAGGTTGAAACTGGAAGAAGGGATGGAAGGGTGTCCAATATTTTAGAGCCCTTGACAAACCTGCCACCAT
TTTTCGCAAACATTTCTCAATTGATATCAATGTTTCGTTCGAAAGGTCTAAGCGTGAAGGACCTCGTAGTGCTTTCAG
GTACTTGAGCATTTCACTTCAGGTTCTTTATAGAGAGTCTTG
TAAGAAGGGATTGTACGGAAGTAAATTCTAATTATTCTGTAATTCTGTCACAAAGGTGGGCACACCATTGGCACTTCTCATTGCTCTTCATTCAGCTCTCGGCTTTACAACTCCACCGGA
AAGGATGGCACCGATCCCACATTGGACTCAGAATACATAGAAAAACTGAAGAGTAGATGCAAGGTAGGAGATCAAACTACGCTAGTAGAGATGGATCCTGGAAGTGTCAGGACATTCGAC
AACAGCTATTATACGCTTGTAGCTAAAAGAAGGGGACTTTTCCAGTCTGATGCAGCTCTCCTTGACAACAGTGAGACAAAAGCTTATGTTAAACTTCAATCTGCTGCGACCCATAGACCC
ACTTTCTTCAAAGACTTTGGTGTTTCCATGATAAATATGGGCAGGGTTGGAGTTCTAACCGGTAAAGCTGGTGAAATCAGGAAAGTTTGCAGCAAGGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGCTCAAAGCTTTCCCCATGTCTAATCTTTCTTCAGGTCGTTTTCTTGGTGTTGGTCTTTAACTCGGCAAATGCGCAGTTGAGGGTAGGGTTTTACAAGGATACATGTCCAAAA
GCTGAGGCTATTGTGGAAGAGGTTATGCATCAAGTGATGAAAGTAGCTCCTAGCCTTAGTGGTCCTTTGTTGAGGATGCACTTTCATGACTGCTTTGTGAGG
GGCTGTGATGGCTCGGTG
CTTTTGAACTCTAGCACTGGCCAAGCTGAAAAGGATTCACCTCCGAACTTAAGCCTTAGAGGATATCAAATTATTGACAGAGTCAAGACTGCATTAGAAAAGGAGTGTCCTGGAGTAGTT
TCCTGTGCGGACATCATGGCCATTGTGGCTAGGGATGTCACGGTTGCG
ACTATGGGACCTTTCTGGGAGGTTGAAACTGGAAGAAGGGATGGAAGGGTGTCCAATATTTTAGAGCCCTTG
ACAAACCTGCCACCATTTTTCGCAAACATTTCTCAATTGATATCAATGTTTCGTTCGAAAGGTCTAAGCGTGAAGGACCTCGTAGTGCTTTCAG
GTGGGCACACCATTGGCACTTCTCAT
TGCTCTTCATTCAGCTCTCGGCTTTACAACTCCACCGGAAAGGATGGCACCGATCCCACATTGGACTCAGAATACATAGAAAAACTGAAGAGTAGATGCAAGGTAGGAGATCAAACTACG
CTAGTAGAGATGGATCCTGGAAGTGTCAGGACATTCGACAACAGCTATTATACGCTTGTAGCTAAAAGAAGGGGACTTTTCCAGTCTGATGCAGCTCTCCTTGACAACAGTGAGACAAAA
GCTTATGTTAAACTTCAATCTGCTGCGACCCATAGACCCACTTTCTTCAAAGACTTTGGTGTTTCCATGATAAATATGGGCAGGGTTGGAGTTCTAACCGGTAAAGCTGGTGAAATCAGG
AAAGTTTGCAGCAAGGTTAATTAA

Retrieve as FASTA