Entry information : PtPrx57 (POPTR_0005s21750 / Potri.005G195700)
Entry ID 3147
Creation 2006-07-21 (Claudia Cosio)
Last sequence changes 2010-06-29 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx57 (POPTR_0005s21750 / Potri.005G195700)
Name (synonym) PtPrx57 (POPTR_0005s21750 / Potri.005G195700)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue types Buds
Flower buds
Leaves
Stems
Inducers Insect damage (Spodoptera exigua, Meloidogyne, Aphib)
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx57
start..stop
S start..stop
PbPrx05 726 0 1..351 1..351
PtPrx67 592 0 1..352 1..353
PtrtrPrx06 551 0 74..351 4..281
PpePrx02 553 0 10..352 14..357
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21246661..21246906 246 N° 2 21247021..21247215 195 N° 3 21247937..21248557 621  
join(21246661..21246906,21247021..21247215,21247937..21248557)


exon

Literature and cross-references PtPrx57 (POPTR_0005s21750 / Potri.005G195700)
Literature Ralph,S., Oddy,C., Cooper,D., Yueh,H., Jancsik,S., Kolosova,N., Philippe,R.N., Aeschliman,D., White,R., Huber,D., Ritland,C.E., Benoit,F., Rigby,T., Nantel,A., Butterfield,Y.S.N., Kirkpatrick,R., Chun,E., Liu,J., Palmquist,D., Wynhoven,B., Stott,J., Yang,G.,Barber,S., Holt,R., Siddiqui,A., Jones,S., Marra,M., Ellis,B.E., Douglas,C.J., Ritland,K. and Bohlmann,J. Genomics of hybrid poplar (Populus trichocarpax deltoides) interacting with forest tent caterpillars (Malacosoma disstria): normalized and full-length cDNA libraries, expressed sequence tags, and a cDNA microarray for the study of insect-induced defences Mol. Ecol. 15 (5), 1275-1297 (2006).
DNA ref. Phytozome 12:   Chr05 (21246661..21248557)
Cluster/Prediction ref. JGI gene:   714785 UniGene:   Pth.8293
Omic ref. ePlant:   Potri.005G195700
Protein sequence: PtPrx57 (POPTR_0005s21750 / Potri.005G195700)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   353 (330)
PWM (Da):   %s   38555.32 (36032.0)  
PI (pH):   %s   5.11 (4.98) Peptide Signal:   %s   cut: 28 range:24-353
Sequence 394
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAITAKSFTFLLISSLFLVSCFCAKEARDTFPVVNGLSWSFYDYSCPKAESIIRKQLKKVFKNDIGQAAGLLRLHFHDCFVQGCDGSVLLDGSASGPSEQDAPPNLTLRPKAFEIIDDLRERIHKECGRVVSCADIAAIAARDSVYLSGGPEYDVPLGRRDGLNFATQNATLANLPPPTANASTILRSLAAKNLDATDVVALSGGHTIGIGHCGSFTERLYPTQDPTMEKTFAEDLKGICPTNSSTNTTVLDIRSPNKFDNKYYVDLVNRQGLFTSDQDLYSYKKTRGIVTSFAEDEALFFEKFVVAMIKMSQLSVLTGNQGEIRANCSVRNSDNSYLVSEVEEDLETKSELR

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (introns 1 and 2) and 13 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTATTACTGCTAAATCCTTCACTTTTCTTCTGATTTCTTCTCTCTTCCTAGTTTCTTGTTTTTGTGCCAAGGAGGCACGGGACACCTTTCCTGTAGTGAATGGTCTCTCATGGTCGT
TCTACGACTATAGCTGTCCTAAAGCTGAATCAATTATAAGAAAACAGCTCAAGAAAGTTTTCAAGAATGATATTGGCCAAGCTGCCGGCTTGCTTCGTCTCCATTTCCACGACTGCTTTG
TTCAG
GTAACAAAGTAATAATAATAAAAAAACAGTATCAAAGACTTTCCGGTATAAAAAAACAGTATCAAAAAACAATGCTATATTAATATGATTTTATTTTGATCGGTGAAATTACAGG
GATGTGATGGCTCAGTGTTGCTTGATGGATCGGCGAGTGGTCCAAGCGAGCAGGACGCCCCTCCCAACCTGACCTTGAGACCAAAGGCATTTGAGATCATCGACGACCTACGCGAGCGCA
TACACAAGGAGTGTGGCCGAGTGGTCTCTTGTGCTGATATTGCCGCAATTGCTGCCCGTGATTCTGTTTACCTG
GTAACCACTTGAATTACTCTCTATATTACGTACAAAGCTTTGTCAT
TGACCATGTTAAACATCATACCATTTATATCCAAGCACTGAAAATTTATGATGTCTGTCAATTTTTATCCAGTTGAGTGATTGCGCAGGAAGCAAATCTGATTTGAGTAGTTGTTACATT
TATCATCTTGTAACTCGTCCAGCATACTGAACTTAATTAATGAACTAGATAGAAAAGGGAGGCTAATTTTATTTTTAATTTTAAACTGGGTCATGATTTTTAGTCGAGACCACACACTTC
TATAGCCATGAAAATTTGGAAGTGTGTAGACTAGTTCAACGTCTTACTAAATCCCAGGTGATGTACTGTGTTTCTAGGTTTTACTATTGCATTATTCATGGTGGAGAAGTTTTCTTTGTT
TTGTTTTTTTCTTTAAATTTTAATTACAGTTTATGACAAGAGCATTAATAATTTGTTCATTTACCGTATGGGGTGGTTGGCTGACTTGGGAGACTTTTGGCGGTCATTATAAAAAGTAAA
CGTATAATAAGTCTCCCTTTTTAAATTTAAAAATTCCAAATTGGCGACAATATCCATCAGTACTATGTCTTACGCTCGATCGGCCAAATGCATGCATGAGCATGATTAATGTGAAACCAT
GTGCAAGGAATAAATTTTCCTAGTCAACACAAAACCTTATCCTTCGTTTTCTTGTGTGAATTTTCTCTATTGCAGTCAGGTGGCCCTGAATATGATGTCCCCTTGGGGAGGCGAGATGGT
CTCAACTTTGCAACGCAAAATGCAACGTTAGCCAACCTGCCACCACCCACTGCAAATGCGAGCACAATTCTCAGATCTCTCGCCGCCAAGAATCTCGATGCCACCGACGTGGTAGCCCTG
TCTGGTGGTCACACCATTGGTATAGGTCACTGTGGCTCTTTCACCGAGCGCCTCTATCCAACCCAAGATCCCACGATGGAGAAAACCTTTGCTGAGGATCTCAAGGGAATTTGCCCTACA
AATAGCTCTACCAACACCACTGTGCTAGATATCAGGTCCCCTAATAAATTTGACAATAAGTACTATGTTGATCTCGTGAACCGCCAAGGCCTGTTTACCTCAGACCAAGACCTGTACTCG
TACAAGAAGACAAGGGGCATCGTCACAAGCTTTGCTGAAGATGAAGCTTTGTTCTTTGAGAAGTTCGTGGTTGCAATGATCAAAATGTCACAGCTTAGCGTATTGACAGGCAACCAAGGA
GAGATTCGTGCCAATTGTTCGGTGAGAAATTCAGACAACAGCTATTTGGTGTCCGAGGTGGAAGAGGATTTGGAGACAAAGTCCGAATTGAGATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTATTACTGCTAAATCCTTCACTTTTCTTCTGATTTCTTCTCTCTTCCTAGTTTCTTGTTTTTGTGCCAAGGAGGCACGGGACACCTTTCCTGTAGTGAATGGTCTCTCATGGTCGT
TCTACGACTATAGCTGTCCTAAAGCTGAATCAATTATAAGAAAACAGCTCAAGAAAGTTTTCAAGAATGATATTGGCCAAGCTGCCGGCTTGCTTCGTCTCCATTTCCACGACTGCTTTG
TTCAG
GGATGTGATGGCTCAGTGTTGCTTGATGGATCGGCGAGTGGTCCAAGCGAGCAGGACGCCCCTCCCAACCTGACCTTGAGACCAAAGGCATTTGAGATCATCGACGACCTACGCG
AGCGCATACACAAGGAGTGTGGCCGAGTGGTCTCTTGTGCTGATATTGCCGCAATTGCTGCCCGTGATTCTGTTTACCTG
TCAGGTGGCCCTGAATATGATGTCCCCTTGGGGAGGCGAG
ATGGTCTCAACTTTGCAACGCAAAATGCAACGTTAGCCAACCTGCCACCACCCACTGCAAATGCGAGCACAATTCTCAGATCTCTCGCCGCCAAGAATCTCGATGCCACCGACGTGGTAG
CCCTGTCTGGTGGTCACACCATTGGTATAGGTCACTGTGGCTCTTTCACCGAGCGCCTCTATCCAACCCAAGATCCCACGATGGAGAAAACCTTTGCTGAGGATCTCAAGGGAATTTGCC
CTACAAATAGCTCTACCAACACCACTGTGCTAGATATCAGGTCCCCTAATAAATTTGACAATAAGTACTATGTTGATCTCGTGAACCGCCAAGGCCTGTTTACCTCAGACCAAGACCTGT
ACTCGTACAAGAAGACAAGGGGCATCGTCACAAGCTTTGCTGAAGATGAAGCTTTGTTCTTTGAGAAGTTCGTGGTTGCAATGATCAAAATGTCACAGCTTAGCGTATTGACAGGCAACC
AAGGAGAGATTCGTGCCAATTGTTCGGTGAGAAATTCAGACAACAGCTATTTGGTGTCCGAGGTGGAAGAGGATTTGGAGACAAAGTCCGAATTGAGATAG

Retrieve as FASTA