Entry information : PtPrx58 (POPTR_0005s14190 / Potri.005G135300)
Entry ID 3148
Creation 2006-06-07 (Claudia Cosio)
Last sequence changes 2010-07-12 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx58 (POPTR_0005s14190 / Potri.005G135300)
Name (synonym) PtPrx58 (POPTR_0005s14190 / Potri.005G135300)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx58
start..stop
S start..stop
PtrtrPrx14 598 0 1..322 1..322
CclPrx59 508 0 2..322 5..329
LuPrx57 498 1e-179 1..322 1..320
PpePrx13 494 3e-178 1..322 1..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11073157..11073372 216 N° 2 11073543..11073719 177 N° 3 11073817..11073982 166 N° 4 11074135..11074544 410
join(11073157..11073372,11073543..11073719,11073817..11073982,11074135..11074544 )


exon

Literature and cross-references PtPrx58 (POPTR_0005s14190 / Potri.005G135300)
Literature DOE joint genome institute.
DNA ref. Phytozome 12:   Chr05 (11073157..11074544)
Omic ref. ePlant:   Potri.005G135300
Protein sequence: PtPrx58 (POPTR_0005s14190 / Potri.005G135300)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (297)
PWM (Da):   %s   35187.53 (32337.1)  
PI (pH):   %s   5.68 (5.14) Peptide Signal:   %s   cut: 26 range:26-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEHNSFKLPFVHLLCLLLLCPLVSCQLNYKFYDYTCPNLTKIVRSGVWSAMRNDSRMAASLLRLHFHDCFVNGCDGSLLLDGGEKNAFPNRNSARGFEVIDDIKANLERACPATVSCTDILTLAAREAVYLSGGPYWFLPLGRRDGLTASESDANEQLPGFSEPLENITAKFTSKGLELKDVVVLSGAHTIGFAQCFTFKSRLFDFGGSGEPDPLLDTALLTSLQSTCPNQDDSDTKLAPLDSASSSKFDNLYYKLLLNNSGLLQSDQALMGDNTTSSLVLNYSKFPYLFSKDFGASMVKMANIGVLTGQNGEIRKNCRLVN

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (chromo 5, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCACAACTCCTTTAAACTTCCCTTTGTTCACTTGCTTTGCCTTCTGCTGTTGTGTCCTCTGGTGTCATGCCAGCTTAATTATAAATTCTATGATTACACATGTCCTAACCTCACA
AAAATTGTTCGATCTGGTGTTTGGTCTGCTATGAGAAATGATTCTAGGATGGCAGCTTCTCTGTTGAGGCTTCACTTTCATGATTGTTTCGTTAAT
GTAATCACTAAAAAAATAAAGTCT
TCTGTTTCCAATATTATAGGATAATACTAGAGCAAAGTCCTCTGCCTCCATTCATATGGAGATTATTGAATCTGTAAACCTTTGCTGCTAAGGCTGACTTCAATTTTTTGTCTTTTGATT
TCTTGTTTCTTCATTTCTATCAACAGGGATGTGATGGGTCTTTGTTACTTGATGGAGGAGAGAAAAATGCATTTCCTAATCGAAACTCGGCTAGAGGTTTTGAAGTCATTGATGACATTA
AAGCCAATTTGGAGAGAGCATGCCCAGCCACAGTTTCTTGTACTGATATACTGACTCTTGCGGCAAGAGAGGCAGTTTATCTT
GTAAGAAATTTGGACTCTTAATTACTTTGTATTCTGC
ATAAAGATCATCCTGCTTGCATTCTAATAGTTGTTGATTCTTTATTTTTATTGTTTTTAGTCCGGAGGCCCATATTGGTTTCTACCCTTGGGCCGCCGAGATGGCCTGACAGCAAGTGAG
AGTGATGCTAATGAGCAGCTCCCAGGATTTTCTGAACCGTTAGAGAACATCACTGCAAAATTTACCTCAAAGGGTCTTGAACTAAAGGATGTGGTTGTGCTCTCAG
GTTTGCCTCCTCCA
TCATATTTTCTATAAAATCACTTGTCTTCCACTGAAAAGAAGTGAGAGGGAAGACTTCGACTTAATCAAATTATGATGATTACTTGAATATTTAAATTTGAACAAACATCAATCTCTAAA
TCTAAATAATAAATACAGGTGCACATACTATTGGATTTGCTCAGTGCTTCACATTTAAGTCTAGACTTTTTGACTTTGGAGGCTCTGGTGAACCAGATCCACTGCTTGATACAGCACTTC
TAACAAGTTTGCAAAGTACGTGCCCAAATCAAGATGATTCTGACACAAAATTGGCTCCATTGGATTCTGCTAGTTCCAGCAAGTTTGATAACTTGTATTACAAGCTTCTTTTGAACAATT
CTGGGCTTCTCCAATCAGACCAAGCTCTCATGGGGGATAATACAACCTCTTCATTGGTCCTTAACTATAGCAAGTTCCCTTATTTGTTTTCCAAGGATTTTGGAGCATCAATGGTCAAGA
TGGCCAACATTGGTGTCCTTACAGGACAAAATGGGGAGATCAGGAAAAATTGTAGGTTGGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCACAACTCCTTTAAACTTCCCTTTGTTCACTTGCTTTGCCTTCTGCTGTTGTGTCCTCTGGTGTCATGCCAGCTTAATTATAAATTCTATGATTACACATGTCCTAACCTCACA
AAAATTGTTCGATCTGGTGTTTGGTCTGCTATGAGAAATGATTCTAGGATGGCAGCTTCTCTGTTGAGGCTTCACTTTCATGATTGTTTCGTTAAT
GGATGTGATGGGTCTTTGTTACTT
GATGGAGGAGAGAAAAATGCATTTCCTAATCGAAACTCGGCTAGAGGTTTTGAAGTCATTGATGACATTAAAGCCAATTTGGAGAGAGCATGCCCAGCCACAGTTTCTTGTACTGATATA
CTGACTCTTGCGGCAAGAGAGGCAGTTTATCTT
TCCGGAGGCCCATATTGGTTTCTACCCTTGGGCCGCCGAGATGGCCTGACAGCAAGTGAGAGTGATGCTAATGAGCAGCTCCCAGGA
TTTTCTGAACCGTTAGAGAACATCACTGCAAAATTTACCTCAAAGGGTCTTGAACTAAAGGATGTGGTTGTGCTCTCAG
GTGCACATACTATTGGATTTGCTCAGTGCTTCACATTTAAG
TCTAGACTTTTTGACTTTGGAGGCTCTGGTGAACCAGATCCACTGCTTGATACAGCACTTCTAACAAGTTTGCAAAGTACGTGCCCAAATCAAGATGATTCTGACACAAAATTGGCTCCA
TTGGATTCTGCTAGTTCCAGCAAGTTTGATAACTTGTATTACAAGCTTCTTTTGAACAATTCTGGGCTTCTCCAATCAGACCAAGCTCTCATGGGGGATAATACAACCTCTTCATTGGTC
CTTAACTATAGCAAGTTCCCTTATTTGTTTTCCAAGGATTTTGGAGCATCAATGGTCAAGATGGCCAACATTGGTGTCCTTACAGGACAAAATGGGGAGATCAGGAAAAATTGTAGGTTG
GTGAACTAG

Retrieve as FASTA