Entry information : PtPrx60 (POPTR_0019s00340 / PT19G00430 / Potri.018G136900)
Entry ID 3150
Creation 2006-06-22 (Claudia Cosio)
Last sequence changes 2010-08-03 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx60 (POPTR_0019s00340 / PT19G00430 / Potri.018G136900)
Name (synonym) PtPrx60 (POPTR_0019s00340 / PT19G00430 / Potri.018G136900)
Class Class III peroxidase    [Orthogroup: Prx026]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx60
start..stop
S start..stop
PtPrx04 573 0 1..316 1..316
GhPrx39 498 1e-179 1..316 9..323
GrPrx39 498 1e-179 1..316 9..323
RcPrx53 495 9e-179 3..316 1..315
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 112546..112761 216 N° 2 113570..113758 189 N° 3 113923..114085 163 N° 4 114250..114632 383
join(112546..112761,113570..113758,113923..114085,114250..114632)


exon

Literature and cross-references PtPrx60 (POPTR_0019s00340 / PT19G00430 / Potri.018G136900)
DNA ref. Phytozome 12:   scaffold_19 (112546..114632)
EST ref. GenBank:   CV243529.1 [5' end]
Omic ref. ePlant:   Potri.018G136900
Protein sequence: PtPrx60 (POPTR_0019s00340 / PT19G00430 / Potri.018G136900)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (298)
PWM (Da):   %s   34462.91 (32512.9)  
PI (pH):   %s   5.06 (5.21) Peptide Signal:   %s   cut: 19 range:19-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMANFLALFLLMELIAGGYRDGANGLSMNYYVFSCPFAEAIVRSTVTSALKSDPTLAAGLVRMHFHDCWIQGCDGSVLIDSTKDNTAEKESPGNQSVRGFELIDDVKEQLEEQCPGVVSCADIVAMAAREAVALSGGPVYDIPKGRKDGRRSKIEDTLSAPAPTFNASELVRVFGLRGFSAQDMVALSGGHTLGVARCLTFKNRLSDPVDPTMDSDFSKTLSKTCSGGDDAEQTFDMTRNNFDNFYFQALQRKSGVLFSDQTLYNNPRTKSIVKDYAMNQAKFFLDFQQAMVKMSLLDVKEGSQGEVRADCRKIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 19, 3 introns) and 1 EST. Frame shift and 6 aa (SALKSD) are missing just before the FHDC in the genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATGGCTAATTTTCTTGCTTTGTTTTTATTGATGGAGTTAATAGCAGGTGGTTATAGAGATGGAGCGAATGGCCTCAGCATGAACTACTACGTTTTCAGCTGCCCATTTGCTGAG
GCAATTGTGAGGAGCACAGTAACAAGTGCTTTGAAGTCTGATCCTACCTTAGCAGCTGGTCTTGTTAGAATGCATTTCCATGATTGCTGGATACAA
GTAATTGCCTTTTTCTTTTTTCCT
TTTTCTTTTTTCTTTTTTAGTTTACTATCTCATTAATTATCCATACACCTCTCTCACGTTCATGCATAATCTTTATCACTAGGGCGTACCGCATGGTAGGTGATAGAGTTAATTTGGATA
TAATATTACTAGGATTATTGAAAATTTCTTAAACTCAAAATTTTAATTTGGAAATTTTTGGTTTAATTTCTATAGGAAAGAAGTAGGGAGATTTATGCATATTAAACAAAGTTTACTTTA
TACTTTGTAAGTAGCTTATGTCACAAATATTATATTCTTCCAAGGCCTTCAAATTTAGGAGGAAAAACAGCCTTGGCATAGAAAAGGTACTCCATCATGCAGTTCTGAATTAATCCTTTA
ATCTAGGATCTAGATGGGGCTAGATTAGTAAAAAAAACATGGATTTAAAAAAAAATTATTTTTTTAAATGTATGTTCACCTTGGTTAATCCTAGCTAATTCACTATCCAAGTTTTAATCC
GGTTTAACCTTGAACTATATTTGGAAATTATGCTCCATAGAGTTAAATCGCCCAGCTAGAAACAAGTGGGTTTAGAAAATAAAAATGAAAAACTCATCCATTAGTATGTATTGATAACTT
GTACTTCATGCAAAATTAATAATCATGATTTTCATATTTTTCTTAATTTAATTCATAATATGTTTATGTAGCAAAATATTTGATTCTGATACTGTGTGTGTGTGTATTAATTAAAATTAA
GCAGTTCAATTGTCTCTTAATCATTTTTTTTCCTTGGTGGGACTGTTCGAAATAATTTAAATAGGGATGTGATGGGTCTGTGCTGATAGACTCAACAAAGGATAACACAGCAGAGAAGGA
ATCTCCAGGAAATCAAAGCGTGAGAGGCTTTGAACTCATTGATGATGTAAAGGAGCAACTTGAAGAGCAATGCCCTGGTGTTGTCTCATGCGCTGACATTGTTGCAATGGCTGCTAGAGA
GGCTGTTGCTTTG
GTAACAATTCAATCCAGGTTTTGATTTTTATTTTTTGAAACCCAACCCTGACCAGGTTCCGGGTTGATCGGGTCTCGAGTTAGCCTGCGTGGTCGGGCTGGGTTTAA
TAACACCGGTTTAACATCTACTGATATATGATGGTCTGGTCATGGTGGGAATTACAGTCAGGAGGTCCAGTTTATGACATACCAAAAGGAAGAAAAGATGGAAGGAGGTCTAAAATTGAA
GATACTCTCAGTGCGCCTGCTCCAACTTTTAATGCCTCGGAGCTCGTTAGAGTCTTTGGCCTCCGTGGTTTTAGTGCCCAAGACATGGTTGCCTTGTCTG
GTAAGCGGTGACCCAATCCC
ATATATATATATGGGATCTTCTTTGTATTTAACTGGACCGGGGATCAATCCTTAAAAGAAGGTTTCTTAAGGATGATTCTGCTCTAATTCTTTCCTTTTCTTCCCTTGAAATCTTATAGT
TTTGTGACAAATTGGTCTATGCAGGGGGGCACACACTAGGGGTGGCAAGGTGTTTAACGTTCAAAAATAGGTTGAGTGACCCTGTTGATCCGACTATGGATTCAGACTTTTCAAAGACTT
TGTCCAAAACATGTAGTGGTGGAGACGATGCAGAACAAACATTTGATATGACAAGAAATAATTTTGATAACTTCTACTTCCAAGCATTGCAGAGGAAATCAGGAGTTCTTTTTTCAGACC
AAACCCTATACAATAATCCAAGAACAAAATCAATTGTCAAAGACTACGCTATGAACCAGGCTAAGTTTTTCCTTGATTTTCAACAGGCAATGGTGAAAATGAGCTTGCTCGATGTCAAGG
AGGGATCACAAGGAGAAGTAAGAGCAGATTGTCGTAAAATTAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATGGCTAATTTTCTTGCTTTGTTTTTATTGATGGAGTTAATAGCAGGTGGTTATAGAGATGGAGCGAATGGCCTCAGCATGAACTACTACGTTTTCAGCTGCCCATTTGCTGAG
GCAATTGTGAGGAGCACAGTAACAAGTGCTTTGAAGTCTGATCCTACCTTAGCAGCTGGTCTTGTTAGAATGCATTTCCATGATTGCTGGATACAA
GGATGTGATGGGTCTGTGCTGATA
GACTCAACAAAGGATAACACAGCAGAGAAGGAATCTCCAGGAAATCAAAGCGTGAGAGGCTTTGAACTCATTGATGATGTAAAGGAGCAACTTGAAGAGCAATGCCCTGGTGTTGTCTCA
TGCGCTGACATTGTTGCAATGGCTGCTAGAGAGGCTGTTGCTTTG
TCAGGAGGTCCAGTTTATGACATACCAAAAGGAAGAAAAGATGGAAGGAGGTCTAAAATTGAAGATACTCTCAGT
GCGCCTGCTCCAACTTTTAATGCCTCGGAGCTCGTTAGAGTCTTTGGCCTCCGTGGTTTTAGTGCCCAAGACATGGTTGCCTTGTCTG
GGGGGCACACACTAGGGGTGGCAAGGTGTTTA
ACGTTCAAAAATAGGTTGAGTGACCCTGTTGATCCGACTATGGATTCAGACTTTTCAAAGACTTTGTCCAAAACATGTAGTGGTGGAGACGATGCAGAACAAACATTTGATATGACAAGA
AATAATTTTGATAACTTCTACTTCCAAGCATTGCAGAGGAAATCAGGAGTTCTTTTTTCAGACCAAACCCTATACAATAATCCAAGAACAAAATCAATTGTCAAAGACTACGCTATGAAC
CAGGCTAAGTTTTTCCTTGATTTTCAACAGGCAATGGTGAAAATGAGCTTGCTCGATGTCAAGGAGGGATCACAAGGAGAAGTAAGAGCAGATTGTCGTAAAATTAACTGA

Retrieve as FASTA