Entry information : PtPrx62 (POPTR_0003s15480 / Potri.003G156100)
Entry ID 3152
Creation 2006-06-06 (Claudia Cosio)
Last sequence changes 2006-06-06 (Claudia Cosio)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx62 (POPTR_0003s15480 / Potri.003G156100)
Name (synonym) PtPrx62 (POPTR_0003s15480 / Potri.003G156100)
Class Class III peroxidase    [Orthogroup: Prx038]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx62
start..stop
S start..stop
MePrx118 494 3e-176 87..398 33..344
LjPrx50 465 8e-165 88..398 41..349
MtPrx100 462 4e-164 74..398 26..342
GmPrx64 462 5e-164 88..397 32..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16855593..16856039 447 N° 2 16854949..16855291 343 N° 3 16854431..16854843 413  
complement(join(16854431..16854843,16854949..16855291,16855593..16856039))


exon

Literature and cross-references PtPrx62 (POPTR_0003s15480 / Potri.003G156100)
Literature DOE joint genome institute.
DNA ref. Phytozome 12:   Chr03 (16856039..16854431)
Omic ref. ePlant:   Potri.003G156100
Protein sequence: PtPrx62 (POPTR_0003s15480 / Potri.003G156100)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   400 (378)
PWM (Da):   %s   44829.94 (42465.6) Transmb domain:   %s   i5-22o
PI (pH):   %s   4.86 (4.79) Peptide Signal:   %s   cut: 23 range:23-400
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKCSFSFGFLLILVLPLILASAQDGKYERAAYHDNYEGAVQKDQDYEGQYQDQEKGPAKYDKNYEKERTPAQNDQHYDQEEQDYHVPSLEISTLLDNLPSDDLLSFGYYSKSCPKAESIINKHVTKWVEEDRTLAASLLRLHFHDCAVHGCDGSILLNHEGSERTSEASKSLRGFEVIDAIKAEMEKECPRTVSCADILTAASRDATVLLGGPYWDVPYGRKDGKVSIDKDAELVPMGRENITTLIEFYQSNGLNVLDLVVLSGAHTIGRATCGSLQYRLYNYAGTGKQDESLDYRYANFLKRKCRWASEYVDLDATTPRTFDNVYYKNLQDKMGLLHTDQSLYSDSRTSPIVDALADAPSDFFNHQFAVSMTKLGNILVPAVQDGGEIRTKCYSVNSNY

Retrieve as FASTA  
Remarks Complete from genomic DNA (introns 1 and 3)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTGCTCTTTTTCCTTTGGTTTTCTCCTCATCCTTGTTCTTCCCTTGATTTTAGCCTCAGCCCAGGACGGAAAATATGAACGCGCGGCCTACCATGATAATTACGAAGGAGCAGTC
CAGAAAGATCAAGATTATGAGGGCCAATACCAAGATCAAGAAAAGGGTCCAGCTAAGTATGATAAAAATTATGAAAAAGAAAGAACGCCAGCACAGAATGATCAACATTACGACCAAGAA
GAACAAGATTATCATGTACCTTCATTGGAGATCTCAACATTGCTGGATAACTTGCCTTCAGATGATCTGTTATCTTTTGGATACTATAGCAAGAGCTGTCCTAAAGCTGAATCCATCATT
AATAAACACGTGACCAAGTGGGTTGAAGAGGACCGAACCCTTGCTGCGAGTCTCCTGAGGTTGCACTTCCATGACTGTGCCGTGCAT
GTAAGAATCCCTTCAAACTGTTTCCTTCGTTTG
TACATTTATTTTGTTTAAGTCTATTTACAATTTCTGTTATTTGAATATTTTAGCTCAAATGCTCTTGTCAAATGACCTTCATACATTCCAATTCTCAAATCAACGTAAAAAAAAACTAGT
ATACCATATAATCCCTCGGTCTTGCACCCCTGTACAATGCTCGTACCCAAATCCGAGCAACATGTGTAGTTACAAGTGATTTTAATTAAACCCTACCTTTCCTCAATGGCATAAAATTAA
TTGCTTATTTATTTATCGTTCTTTACAGGGTTGTGATGGCTCCATTCTGTTGAACCATGAGGGAAGTGAGAGAACATCAGAGGCAAGCAAGTCTCTTAGGGGGTTTGAAGTAATCGATGC
TATCAAAGCTGAGATGGAGAAAGAGTGCCCAAGAACTGTATCGTGCGCTGACATTCTTACCGCAGCCTCTAGAGATGCTACCGTTCTTCTTGGCGGTCCATACTGGGACGTGCCCTATGG
AAGGAAAGATGGGAAAGTTTCTATTGACAAGGATGCTGAATTGGTGCCAATGGGCAGGGAAAACATCACTACCCTGATTGAATTCTACCAATCTAATGGTTTGAATGTCCTTGATTTGGT
GGTTCTCTCAG
GTGAATTAATAGCATAATTATTAGTGTTTAATTAAGAACTTGAGAGCCAAATGTGGATATGGATCTATACTAAATGTAGTTAATGCTCTGTTTTGTGTTTGACAGGGGC
ACATACAATTGGCAGGGCTACATGCGGTTCACTACAATATAGGCTGTACAACTATGCAGGAACCGGCAAACAAGATGAATCCCTTGATTATAGATACGCGAACTTCTTGAAAAGAAAATG
CAGATGGGCCTCTGAGTATGTTGATCTAGATGCTACAACCCCACGGACTTTTGACAATGTTTACTACAAGAATCTTCAAGACAAGATGGGACTTCTGCACACAGATCAATCGCTATATTC
TGATTCAAGGACTTCTCCAATTGTTGATGCGTTGGCTGATGCGCCTTCCGATTTCTTCAATCACCAGTTTGCAGTGTCGATGACAAAGCTCGGCAATATTCTAGTCCCTGCAGTTCAAGA
CGGAGGTGAAATTCGAACCAAATGCTACTCCGTCAATTCTAATTATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTGCTCTTTTTCCTTTGGTTTTCTCCTCATCCTTGTTCTTCCCTTGATTTTAGCCTCAGCCCAGGACGGAAAATATGAACGCGCGGCCTACCATGATAATTACGAAGGAGCAGTC
CAGAAAGATCAAGATTATGAGGGCCAATACCAAGATCAAGAAAAGGGTCCAGCTAAGTATGATAAAAATTATGAAAAAGAAAGAACGCCAGCACAGAATGATCAACATTACGACCAAGAA
GAACAAGATTATCATGTACCTTCATTGGAGATCTCAACATTGCTGGATAACTTGCCTTCAGATGATCTGTTATCTTTTGGATACTATAGCAAGAGCTGTCCTAAAGCTGAATCCATCATT
AATAAACACGTGACCAAGTGGGTTGAAGAGGACCGAACCCTTGCTGCGAGTCTCCTGAGGTTGCACTTCCATGACTGTGCCGTGCAT
GGTTGTGATGGCTCCATTCTGTTGAACCATGAG
GGAAGTGAGAGAACATCAGAGGCAAGCAAGTCTCTTAGGGGGTTTGAAGTAATCGATGCTATCAAAGCTGAGATGGAGAAAGAGTGCCCAAGAACTGTATCGTGCGCTGACATTCTTACC
GCAGCCTCTAGAGATGCTACCGTTCTTCTTGGCGGTCCATACTGGGACGTGCCCTATGGAAGGAAAGATGGGAAAGTTTCTATTGACAAGGATGCTGAATTGGTGCCAATGGGCAGGGAA
AACATCACTACCCTGATTGAATTCTACCAATCTAATGGTTTGAATGTCCTTGATTTGGTGGTTCTCTCAG
GGGCACATACAATTGGCAGGGCTACATGCGGTTCACTACAATATAGGCTG
TACAACTATGCAGGAACCGGCAAACAAGATGAATCCCTTGATTATAGATACGCGAACTTCTTGAAAAGAAAATGCAGATGGGCCTCTGAGTATGTTGATCTAGATGCTACAACCCCACGG
ACTTTTGACAATGTTTACTACAAGAATCTTCAAGACAAGATGGGACTTCTGCACACAGATCAATCGCTATATTCTGATTCAAGGACTTCTCCAATTGTTGATGCGTTGGCTGATGCGCCT
TCCGATTTCTTCAATCACCAGTTTGCAGTGTCGATGACAAAGCTCGGCAATATTCTAGTCCCTGCAGTTCAAGACGGAGGTGAAATTCGAACCAAATGCTACTCCGTCAATTCTAATTAT
TGA

Retrieve as FASTA