Entry information : PtPrx70 (POPTR_0004s15200 / Potri.004G144600)
Entry ID 3160
Creation 2006-06-14 (Claudia Cosio)
Last sequence changes 2010-06-17 (Marie Brette (Scipio))
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx70 (POPTR_0004s15200 / Potri.004G144600)
Name (synonym) PtPrx70 (POPTR_0004s15200 / Potri.004G144600)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx70
start..stop
S start..stop
PtrePrx02 643 0 1..337 1..337
PtPrx80 583 0 1..337 1..337
RcPrx31 497 1e-178 1..337 1..335
MePrx117 495 4e-178 1..337 1..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15850441..15850686 246 N° 2 15849738..15849929 192 N° 3 15849480..15849645 166 N° 4 15848745..15849154 410
complement(join(15848745..15849154,15849480..15849645,15849738..15849929,1585044 1..15850686))


exon

Literature and cross-references PtPrx70 (POPTR_0004s15200 / Potri.004G144600)
Literature DOE joint genome institute.
DNA ref. Phytozome 12:   scaffold_4 (15850686..15848745)
Omic ref. ePlant:   Potri.004G144600
Protein sequence: PtPrx70 (POPTR_0004s15200 / Potri.004G144600)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337 (312)
PWM (Da):   %s   36321.16 (33513.6)  
PI (pH):   %s   7.3 (6.74) Peptide Signal:   %s   cut: 26 range:26-337
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAITRFSYSTILALLYLSLLHLVTSFPSSNGQIDYNYNYNYYDSSCPRLGMIVKYGVWAAFKNDTRIAASLLRLHFHDCFVNGCDASVLLDDTINFRGEKNALPNRNSARGYEVIESIKADVEKACPSTVSCVDILALAARESVLLSGGPYYPLSLGGLDGLTASEKAANEQLPSPFEPLENITAKFASKGLDIKDVVVLSGAHTIGFAQCFSFKRRLFDFKGTGKPDPTLDSSAVANLQGTCPNKDASNSKLAPLDSASTYRFDNAYYVNLVNRTGLLESDQALMGDSKTAAMVTAYSSNSYLFSADFASSMVKMSNLGILTGSNGQIRKKCGSVN

Retrieve as FASTA  
Remarks complete sequence from genomic DNA (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATCACACGCTTCTCATACTCCACCATTCTAGCTCTTCTTTACCTGTCTTTGCTTCACTTAGTCACTTCGTTCCCTTCTTCTAATGGTCAGATTGATTACAATTACAACTATAAT
TACTATGATAGCTCATGCCCTCGTTTGGGAATGATTGTCAAGTATGGTGTCTGGGCTGCTTTCAAGAATGACACCAGAATAGCCGCATCCCTCCTTCGATTGCATTTCCACGACTGCTTT
GTAAAT
GTAAAGCTATTTCTCTTTTACTCAACCACATTTCTCTCTTGCTAGGTGGTCTGTTTTTCCAAAGCAGATGTTGAAAAGGCTAGGCCCCATGCAAAGGACAGTTTGTAACCAACA
TGGGAGAGATCCAATGTTTTCGTCCTTTGGGCCCAGAAGGTTCAAATTCCTTGTTCAACCTTGAATAAGAGAGCCCACTAAATAGATTTTGGTGCCCACCAGTCGGCTGTGCTCTGTATA
CTAGTCGGGTTCTTTTATCGGATGTTATCCTCTGCTAGTTTCCTCGAATTAAATCAAAAACGATTAAAAAATCAAAACATGGGATGGGAGTGTTTTAACAAGGTTTAATTTGTCTAACCA
GAAGATCTATGAGCTTGGTGTTATTGAGTTTCCTGTCTGTGGGTGCATGCCTTTTTTCTGTAGCGGAAAATTTAGAATTCAGTCTGTTACTCCACTCCCACGACACGTAAACTTCTTTGT
TTTGAATTAAAGTTATGGTATTTCGTGTGTAACACAGGGCTGCGATGCTTCCGTACTTCTGGACGACACAATTAATTTCAGGGGAGAGAAGAATGCTCTTCCCAACCGCAATTCAGCTAG
AGGATATGAAGTCATTGAAAGCATCAAAGCAGATGTTGAAAAGGCTTGCCCATCAACTGTTTCATGTGTTGATATATTGGCTCTTGCAGCAAGAGAATCTGTCCTTCTG
GTATTGACATT
GGCCATGTTCATTCATTGCAGAGCATTTTCTATTTGCTCTAAATTTCTGATTTATGTGTTTACTTCATTCACCTGTTTCAGTCAGGAGGGCCTTATTATCCTCTTTCATTGGGCGGGCTA
GATGGATTGACTGCAAGTGAGAAGGCAGCTAATGAACAATTGCCATCACCATTTGAACCACTAGAAAACATCACTGCTAAGTTCGCATCAAAGGGTCTTGACATTAAGGATGTTGTAGTC
CTCTCAG
GTTCTTGTCATCTTCGCTTTCTCTGGTTATCTCTCTCTCTCTCTCTCTCTCTCTCTATTTTAAGCTAGTCAATAGAGTGGTGTTCTTGCTCAAACCATAGAGCTTAAATCGGC
GACGAAATCTGTGACTCTTATCCTTTTAGATGGCCACGTATTGTCGCCATATATATGCTTGCAATCTATACATGTATTGAGCCTAAGCTCAGGTTTTTGACGACCAAATTTTTGGCGATA
ACACCAACCCAAGGAACAGAGCAGAAGGCTTTTTTAAACTAATTTCTAATATTTTTGGCACAAACAATTAATTTGTTTTTCGTCTATTACAGGGGCACACACCATAGGTTTTGCTCAGTG
CTTCTCCTTCAAGAGGAGGCTCTTCGACTTCAAAGGCACCGGCAAGCCTGACCCCACACTTGATTCTTCGGCCGTGGCAAACTTACAGGGCACGTGTCCAAATAAGGATGCATCAAACAG
CAAACTTGCTCCTCTTGACTCTGCAAGCACATACCGATTTGACAATGCTTATTATGTGAACCTCGTGAACAGAACTGGCCTTCTTGAATCTGATCAAGCTCTCATGGGGGATTCCAAGAC
TGCTGCAATGGTTACTGCCTACAGCTCAAATTCATATCTTTTCTCAGCTGATTTCGCATCATCAATGGTAAAGATGAGCAACCTTGGGATACTTACAGGCAGCAATGGACAAATTAGAAA
GAAATGTGGGTCTGTCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATCACACGCTTCTCATACTCCACCATTCTAGCTCTTCTTTACCTGTCTTTGCTTCACTTAGTCACTTCGTTCCCTTCTTCTAATGGTCAGATTGATTACAATTACAACTATAAT
TACTATGATAGCTCATGCCCTCGTTTGGGAATGATTGTCAAGTATGGTGTCTGGGCTGCTTTCAAGAATGACACCAGAATAGCCGCATCCCTCCTTCGATTGCATTTCCACGACTGCTTT
GTAAAT
GGCTGCGATGCTTCCGTACTTCTGGACGACACAATTAATTTCAGGGGAGAGAAGAATGCTCTTCCCAACCGCAATTCAGCTAGAGGATATGAAGTCATTGAAAGCATCAAAGCA
GATGTTGAAAAGGCTTGCCCATCAACTGTTTCATGTGTTGATATATTGGCTCTTGCAGCAAGAGAATCTGTCCTTCTG
TCAGGAGGGCCTTATTATCCTCTTTCATTGGGCGGGCTAGAT
GGATTGACTGCAAGTGAGAAGGCAGCTAATGAACAATTGCCATCACCATTTGAACCACTAGAAAACATCACTGCTAAGTTCGCATCAAAGGGTCTTGACATTAAGGATGTTGTAGTCCTC
TCAG
GGGCACACACCATAGGTTTTGCTCAGTGCTTCTCCTTCAAGAGGAGGCTCTTCGACTTCAAAGGCACCGGCAAGCCTGACCCCACACTTGATTCTTCGGCCGTGGCAAACTTACAG
GGCACGTGTCCAAATAAGGATGCATCAAACAGCAAACTTGCTCCTCTTGACTCTGCAAGCACATACCGATTTGACAATGCTTATTATGTGAACCTCGTGAACAGAACTGGCCTTCTTGAA
TCTGATCAAGCTCTCATGGGGGATTCCAAGACTGCTGCAATGGTTACTGCCTACAGCTCAAATTCATATCTTTTCTCAGCTGATTTCGCATCATCAATGGTAAAGATGAGCAACCTTGGG
ATACTTACAGGCAGCAATGGACAAATTAGAAAGAAATGTGGGTCTGTCAATTAA

Retrieve as FASTA