Entry information : PtPrx72(POPTR_0149s00200 / Potri.016G058200)
Entry ID 3164
Creation 2006-06-22 (Claudia Cosio)
Last sequence changes 2006-06-22 (Claudia Cosio)
Sequence status complete
Reviewer Catherine
Last annotation changes 2020-04-07 (Catherine )
Peroxidase information: PtPrx72(POPTR_0149s00200 / Potri.016G058200)
Name PtPrx72(POPTR_0149s00200 / Potri.016G058200)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue types Leaves
Stems
Inducers Insect damage (Spodoptera exigua, Meloidogyne, Aphib)
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx72
start..stop
S start..stop
PbPrx72 667 0 1..331 1..331
PalPrx05 604 0 3..331 1..329
MePrx53 558 0 2..331 4..334
RcPrx16 558 0 12..331 16..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3938883..3939101 219 N° 2 3939193..3939384 192 N° 3 3939555..3939720 166 N° 4 3939807..3940225 419
join(3938883..3939101,3939193..3939384,3939555..3939720,3939807..3940225)


exon

Literature and cross-references PtPrx72(POPTR_0149s00200 / Potri.016G058200)
Literature Ralph,S., Oddy,C., Cooper,D., Yueh,H., Jancsik,S., Kolosova,N., Philippe,R.N., Aeschliman,D., White,R., Huber,D., Ritland,C.E., Benoit,F., Rigby,T., Nantel,A., Butterfield,Y.S.N., Kirkpatrick,R., Chun,E., Liu,J., Palmquist,D., Wynhoven,B., Stott,J., Yang,G.,Barber,S., Holt,R., Siddiqui,A., Jones,S., Marra,M., Ellis,B.E., Douglas,C.J., Ritland,K. and Bohlmann,J. Genomics of hybrid poplar (Populus trichocarpax deltoides) interacting with forest tent caterpillars (Malacosoma disstria): normalized and full-length cDNA libraries, expressed sequence tags, and a cDNA microarray for the study of insect-induced defences Mol. Ecol. 15 (5), 1275-1297 (2006)
DNA ref. Phytozome 12:   Chr16 (3938883..3940225)
Cluster/Prediction ref. UniGene:   Pth.5543
Omic ref. ePlant:   Potri.016G058200
Protein sequence: PtPrx72(POPTR_0149s00200 / Potri.016G058200)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (305)
PWM (Da):   %s   34848 (32121.6)  
PI (pH):   %s   5.18 (4.72) Peptide Signal:   %s   cut: 27 range:27-331
Sequence 372
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSPPPSTSFFSVAIVLLGMMLPHSKAQLNATFYANTCPNVSSIVSNVVQQAFQSDSRIGASLIRLHFHDCFVNGCDASILLDNSSSILSEKFAAPNVNSIRGFGVVDNIKTAVENSCPGVVSCADILALAAESSVSQSGGPSWSVLLGRRDSLTANQAGANTAIPSPFEGLNNITAKFSAVGLNTNDLVALSGAHTFGRAQCRTFSNRLYNFSNTGNPDPTLNTTYLTTLQQICPQNGSGTALANLDPTTSDAFDNNYFTNLQNNQGLLQSDQELFSTPGAATITFVNNFSSNQTAFFQSFVQSMINMGNISPLTGSSGEIRSDCKKVNGS

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (3 introns) and 2 ESTs (DT492215, DT490669).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCTCCTCCTCCTTCTACCAGTTTCTTTTCAGTGGCAATAGTCTTGCTAGGAATGATGCTGCCCCACTCGAAAGCTCAATTAAATGCAACTTTCTATGCTAATACATGCCCCAATGTGT
CTAGCATCGTTAGCAACGTTGTTCAGCAGGCTTTTCAATCTGATTCTCGGATTGGCGCCAGCCTTATTCGCCTCCATTTTCATGATTGCTTCGTCAAT
GTAAACTGAATATCATCATTTA
ATTTCTTTGAAGTGGTTTTTAATTAACGCTTGACATTATGTTGATCAAAAAATTTGATTTTTTGGACAGGGATGTGATGCTTCAATTCTACTGGACAACAGTTCAAGCATACTCAGCGAA
AAGTTTGCCGCTCCCAATGTAAATTCCATTCGGGGTTTCGGTGTTGTTGACAACATCAAGACTGCCGTGGAGAATTCTTGCCCTGGTGTTGTCTCCTGCGCTGACATTCTTGCACTTGCT
GCCGAATCATCTGTTTCTCAG
GTAATTACTTAGTCCATACACTGAACTTGTTCTCGGAACTCTTCATTTTGCTTGATTTGGCAAGTCAATGTGATCTGTGTATGCTCAGAAGTTTTCACA
AGTGAAATATTCTATGAAAGGCCGAAAAAACACGAAGCCATGACATACTCTGCTTTTAATGATTCTTGTAGTCAGGAGGTCCTTCATGGAGTGTTCTGTTGGGAAGAAGGGATAGTCTAA
CAGCAAATCAGGCTGGAGCCAATACAGCAATCCCTTCTCCTTTTGAAGGCCTAAACAACATCACTGCAAAGTTCTCTGCAGTAGGTCTAAACACCAATGACCTTGTTGCATTATCAG
GTA
ATTATACCTCAAAAATCTCAAAACTGCATCCAGAATTCTGGAAATCCAACACTAATATATTTTTATTTTTTTATAATTTCCAGGAGCACACACATTCGGACGTGCACAATGTCGAACCTT
TAGCAACAGGCTGTACAATTTTAGCAACACAGGCAACCCTGACCCAACACTAAACACAACATACTTGACTACTCTGCAACAAATATGTCCACAAAATGGCAGCGGAACTGCTTTGGCCAA
CCTTGATCCTACAACTTCAGATGCCTTTGACAATAATTACTTCACCAACCTACAAAACAATCAAGGTCTTCTCCAATCAGACCAAGAGTTATTTTCCACACCTGGCGCTGCCACGATCAC
TTTTGTCAATAACTTCAGCAGCAACCAAACTGCCTTCTTCCAGAGTTTTGTTCAGTCAATGATTAATATGGGTAATATTAGCCCATTAACTGGGAGTAGTGGAGAGATCAGGTCAGACTG
CAAAAAGGTCAATGGAAGTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCTCCTCCTCCTTCTACCAGTTTCTTTTCAGTGGCAATAGTCTTGCTAGGAATGATGCTGCCCCACTCGAAAGCTCAATTAAATGCAACTTTCTATGCTAATACATGCCCCAATGTGT
CTAGCATCGTTAGCAACGTTGTTCAGCAGGCTTTTCAATCTGATTCTCGGATTGGCGCCAGCCTTATTCGCCTCCATTTTCATGATTGCTTCGTCAAT
GGATGTGATGCTTCAATTCTAC
TGGACAACAGTTCAAGCATACTCAGCGAAAAGTTTGCCGCTCCCAATGTAAATTCCATTCGGGGTTTCGGTGTTGTTGACAACATCAAGACTGCCGTGGAGAATTCTTGCCCTGGTGTTG
TCTCCTGCGCTGACATTCTTGCACTTGCTGCCGAATCATCTGTTTCTCAG
TCAGGAGGTCCTTCATGGAGTGTTCTGTTGGGAAGAAGGGATAGTCTAACAGCAAATCAGGCTGGAGCCA
ATACAGCAATCCCTTCTCCTTTTGAAGGCCTAAACAACATCACTGCAAAGTTCTCTGCAGTAGGTCTAAACACCAATGACCTTGTTGCATTATCAG
GAGCACACACATTCGGACGTGCAC
AATGTCGAACCTTTAGCAACAGGCTGTACAATTTTAGCAACACAGGCAACCCTGACCCAACACTAAACACAACATACTTGACTACTCTGCAACAAATATGTCCACAAAATGGCAGCGGAA
CTGCTTTGGCCAACCTTGATCCTACAACTTCAGATGCCTTTGACAATAATTACTTCACCAACCTACAAAACAATCAAGGTCTTCTCCAATCAGACCAAGAGTTATTTTCCACACCTGGCG
CTGCCACGATCACTTTTGTCAATAACTTCAGCAGCAACCAAACTGCCTTCTTCCAGAGTTTTGTTCAGTCAATGATTAATATGGGTAATATTAGCCCATTAACTGGGAGTAGTGGAGAGA
TCAGGTCAGACTGCAAAAAGGTCAATGGAAGTTAG

Retrieve as FASTA