Entry information : PtPrx73 (POPTR_0016s14030 / Potri.016G132700)
Entry ID 3166
Creation 2008-08-15 (Christophe Dunand)
Last sequence changes 2008-08-15 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx73 (POPTR_0016s14030 / Potri.016G132700)
Name (synonym) PtPrx73 (POPTR_0016s14030 / Potri.016G132700)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type Flower buds
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx73
start..stop
S start..stop
MePrx139 475 9e-171 1..317 1..321
PpePrx22 464 1e-166 1..317 1..324
GrPrx38 459 2e-164 14..317 12..323
GhPrx38 456 2e-163 14..317 12..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13281020..13281250 231 N° 2 13281746..13281922 177 N° 3 13282021..13282189 169 N° 4 13282303..13282679 377
join(13281020..13281250,13281746..13281922,13282021..13282189,13282303..13282679 )


exon

Literature and cross-references PtPrx73 (POPTR_0016s14030 / Potri.016G132700)
Literature REFERENCE 1 Sterky,F., Bhalerao,R.R., Unneberg,P., Segerman,B., Nilsson,P., Brunner,A.M., Charbonnel-Campaa,L., Lindvall,J.J., Tandre,K., Strauss,S.H., Sundberg,B., Gustafsson,P., Uhlen,M., Bhalerao,R.P., Nilsson,O., Sandberg,G., Karlsson,J., Lundeberg,J. and Jansson,S. A Populus EST resource for plant functional genomics. Proc. Natl. Acad. Sci. U.S.A. 101 (38), 13951-13956 (2004).
REFERENCE 2 DOE joint genome institute.
DNA ref. Phytozome 12:   scaffold_16 (13281020..13282679)
EST ref. GenBank:   DN485311   BU869110 [5' end]
Cluster/Prediction ref. UniGene:   Pth.16170
Omic ref. ePlant:   Potri.016G132700
Protein sequence: PtPrx73 (POPTR_0016s14030 / Potri.016G132700)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (287)
PWM (Da):   %s   33269.39 (30149.8)  
PI (pH):   %s   8 (7.70) Peptide Signal:   %s   cut: 31 range:31-317
Sequence 358
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASFNSSSSTITTFKFHFGAFLLLVGVASAQLASNFYGTSCPSVLSVIKSAVDSAVSNEARMGASLLRLHFHDCFVNGCDASVLLDGGEKTAPANTNSLRGFEVIDSIKTQLESSCPGVVSCADILSVAARDSVVALGGPSWQVQLGRRDSATAGSVSDVNNNVPSPALSVSGLISAFSNKGFTAKEMVALSGSHTIGQARCTTFLTRINNETNIDSSFKTSTQAQCQNTNNFVPLDVTSPTSFDSAYYRNLLNQKGLLHSDQQLFSGGSTDAQVRAYSSNQAAFRTDFANAMIKMGNLSPLTGTNGQIRTNCRKAN

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (3 introns) and 3 ESTs. Contig also contain PtPrx71 and 74.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTCTTTTAACTCTTCCTCATCAACCATCACTACCTTCAAATTCCATTTTGGGGCATTTCTGCTTCTTGTTGGTGTTGCTTCTGCTCAATTAGCTTCAAACTTCTATGGAACATCAT
GCCCCAGTGTCCTTTCTGTCATTAAATCAGCTGTTGACTCAGCAGTGTCAAATGAGGCTCGCATGGGGGCATCCTTGCTCCGTCTTCATTTCCATGATTGCTTTGTTAAT
GCAAGTTGTC
TGCCTTTTTTTTTTTTATCATCACCTCCCTATTAATCTTATTTTTCTATACTTTATTAAACTTTTTTTAAGAAATCTTTCACTTGCTATTTTGCATATTCATGTATGGCACATAACACAA
CTACATGCTAGTCAGTTAGCTGCTAGAAATTAATCTTCTTCTCTTTTTACGAACTTAATCCAAGATCAATTATAACAAAAAAAAATCTCGTGATTTTTATATGATGCACATAATTAGTTA
GTAAGATTAAGAATAAAAAATAAAAGCACCTTCACTTTTATTTCCAATTCCTCCCTTCAAAAGTAAAAGAAATAATTCAGCCCGGTATTGTTGACCTTCCAGCTAAAGCTAGCTGGTCTT
GTCTTGTCCCTTTGTATTTTTGCATGGATTCATCATGTCATGTTTACTTGGCATGCAGAGTTTTTTCCTGACTATGTCATACTGTTGAATTTGCTTTTAATTGGTGGAACAATATTGTGA
AGCAGGGGTGTGATGCATCAGTGCTTTTGGACGGTGGAGAAAAGACAGCACCAGCAAATACTAATTCTCTGAGAGGTTTCGAAGTTATTGACAGTATTAAAACTCAATTAGAGAGTTCCT
GCCCTGGTGTTGTGTCCTGTGCTGACATCTTATCTGTTGCTGCTCGGGACTCTGTTGTTGCT
GTAAGAAAAATACCAATTTTCATGGCTTCCTCTGTGTGTGTGTGTGTGTGTGTGTGTG
TAATTACATTTTCTAAAATATTTGGATCGTTTTGTTTCAGTTGGGTGGTCCTAGTTGGCAAGTTCAATTGGGCAGGAGAGATTCAGCCACAGCAGGAAGTGTTAGCGATGTTAATAACAA
CGTCCCTTCCCCAGCCTTGAGTGTCAGTGGCCTCATCTCTGCCTTCTCTAACAAAGGTTTCACAGCTAAAGAAATGGTGGCTCTTTCTG
GTATGCTTATTTTTTTGTCATTTTTGAACTT
CATGGCAGTTAAAGCCAATAATTGGCTAGGCATAGAAAAGCAATTGACCATTGTTTTGTTTTCTTGATTTCTTGTGTTGCAGGATCTCACACAATAGGGCAAGCAAGATGTACCACATTC
CTAACCAGAATCAACAATGAAACCAACATAGATTCCTCGTTCAAAACATCAACACAAGCTCAATGTCAGAATACTAACAATTTTGTTCCTTTGGATGTCACGAGCCCAACATCTTTCGAC
AGTGCTTACTACAGGAACTTACTGAACCAAAAGGGTCTTTTACACTCTGACCAGCAACTCTTTAGTGGGGGCTCTACAGATGCTCAAGTTAGGGCTTATAGCTCTAATCAGGCTGCTTTC
AGGACAGACTTTGCAAATGCAATGATAAAGATGGGAAACCTTAGCCCACTTACTGGCACAAATGGCCAGATCAGGACCAATTGCAGGAAGGCCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTCTTTTAACTCTTCCTCATCAACCATCACTACCTTCAAATTCCATTTTGGGGCATTTCTGCTTCTTGTTGGTGTTGCTTCTGCTCAATTAGCTTCAAACTTCTATGGAACATCAT
GCCCCAGTGTCCTTTCTGTCATTAAATCAGCTGTTGACTCAGCAGTGTCAAATGAGGCTCGCATGGGGGCATCCTTGCTCCGTCTTCATTTCCATGATTGCTTTGTTAAT
GGGTGTGATG
CATCAGTGCTTTTGGACGGTGGAGAAAAGACAGCACCAGCAAATACTAATTCTCTGAGAGGTTTCGAAGTTATTGACAGTATTAAAACTCAATTAGAGAGTTCCTGCCCTGGTGTTGTGT
CCTGTGCTGACATCTTATCTGTTGCTGCTCGGGACTCTGTTGTTGCT
TTGGGTGGTCCTAGTTGGCAAGTTCAATTGGGCAGGAGAGATTCAGCCACAGCAGGAAGTGTTAGCGATGTTA
ATAACAACGTCCCTTCCCCAGCCTTGAGTGTCAGTGGCCTCATCTCTGCCTTCTCTAACAAAGGTTTCACAGCTAAAGAAATGGTGGCTCTTTCTG
GATCTCACACAATAGGGCAAGCAA
GATGTACCACATTCCTAACCAGAATCAACAATGAAACCAACATAGATTCCTCGTTCAAAACATCAACACAAGCTCAATGTCAGAATACTAACAATTTTGTTCCTTTGGATGTCACGAGCC
CAACATCTTTCGACAGTGCTTACTACAGGAACTTACTGAACCAAAAGGGTCTTTTACACTCTGACCAGCAACTCTTTAGTGGGGGCTCTACAGATGCTCAAGTTAGGGCTTATAGCTCTA
ATCAGGCTGCTTTCAGGACAGACTTTGCAAATGCAATGATAAAGATGGGAAACCTTAGCCCACTTACTGGCACAAATGGCCAGATCAGGACCAATTGCAGGAAGGCCAATTGA

Retrieve as FASTA