Entry information : PtPrx74 (POPTR_0016s14040 / Potri.016G132800)
Entry ID 3167
Creation 2006-05-31 (Claudia Cosio)
Last sequence changes 2006-05-31 (Claudia Cosio)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx74 (POPTR_0016s14040 / Potri.016G132800)
Name (synonym) PtPrx74 (POPTR_0016s14040 / Potri.016G132800)
Class Class III peroxidase    [Orthogroup: Prx040]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx74
start..stop
S start..stop
PtPrx112 526 0 1..320 1..321
PtPrx71 506 0 1..320 1..321
RcPrx56 502 0 1..320 1..320
MePrx81 495 1e-178 1..320 1..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13636726..13636944 219 N° 2 13637060..13637254 195 N° 3 13637444..13637992 549  
join(13636726..13636944,13637060..13637254,13637444..13637992)


exon

Literature and cross-references PtPrx74 (POPTR_0016s14040 / Potri.016G132800)
Literature DOE joint genome institute.
DNA ref. Phytozome 12:   Chr16 (13636726..13637992)
Omic ref. ePlant:   Potri.016G132800
Protein sequence: PtPrx74 (POPTR_0016s14040 / Potri.016G132800)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (296)
PWM (Da):   %s   34701.95 (32191.6)  
PI (pH):   %s   9.74 (9.74) Peptide Signal:   %s   cut: 25 range:25-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVSRTIFCLSAFLVLLVLATSASSSKVLSPYYYNHVCPKALATIKRVVEAAVYKERRMGASLLRLHFHDCFVNGCDASILLDSTSTIDSEKNALPNINSLRGFEVIDQVKSEVDKICGRPVVSCADIVAVAARDSVVALGGPTWAVQLGRKDSNTASRDKANNDLPSPFMDLPALINNFKRQGLNERDLVALSGGHTLGSAQCFTFRNRIHNETNIDPKFVKQRKPTCPLVGGDSNLAPLDPTPAHFDVAYFNSLVKKRGLLRSDQALFNGGSTDGLVKAYSSNAKAFWADFAKSMVKMGNINVLTGKQGQVRLNCRKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (introns 1 and 2). Contig also contains PtPrx71 and 73. ESTs from hybrids.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCTCGTACCATCTTCTGTCTTTCTGCCTTCCTTGTGCTTTTGGTTCTTGCTACTTCTGCTTCTTCTTCAAAAGTACTATCTCCATATTACTATAACCATGTGTGTCCCAAAGCT
TTAGCAACTATCAAACGAGTTGTGGAGGCTGCAGTTTACAAAGAAAGACGCATGGGTGCTTCTTTGTTGCGTCTACACTTCCATGATTGTTTTGTCAAT
GTATTACACTAATCACATTCT
AATTTCTCCTAATTATTTAATAGTATCACATAATTATGCTTTACATGCATATTGTTCTTATACTAATGGTCTTGGTTGTATATATGTGATATAGGGTTGTGATGCATCAATTCTTTTGGA
TTCAACATCCACCATTGACAGTGAAAAGAATGCGTTGCCTAATATCAATTCTCTTAGAGGATTTGAAGTTATTGACCAAGTTAAGTCGGAGGTGGACAAAATCTGTGGACGTCCAGTGGT
CTCATGTGCAGATATCGTAGCTGTTGCAGCCCGGGACTCCGTCGTTGCG
GTATGTGATCGATTAAAGAGTTGTTTTGTATATATAGTTGGTGGTTCAGTATTTTGTTTTTTCAAATATTT
GAAAATGAGAATGAAAATATTTGAATTTAGAATTTATTAATAAATTATCATGCATGCCGGCTATAAAATTTAATTAACATTGCAATCTACATATTTGCTCATATTAAAATATGTGCAGCT
AGGAGGGCCAACATGGGCCGTCCAACTAGGAAGGAAGGACTCAAACACAGCTAGCAGAGACAAAGCCAACAATGACCTCCCATCACCATTCATGGATCTTCCTGCCCTAATCAACAACTT
CAAAAGGCAGGGTTTAAATGAGAGAGACCTTGTAGCTCTCTCCGGAGGCCACACTTTAGGGTCAGCACAGTGTTTTACGTTCAGAAACAGAATCCACAATGAAACAAATATCGACCCTAA
ATTTGTTAAACAGCGCAAACCAACATGTCCACTCGTTGGAGGTGACTCGAACCTTGCTCCTCTAGACCCAACACCTGCACACTTTGATGTTGCATACTTCAACAGTTTGGTGAAGAAAAG
AGGGTTGCTTCGCTCTGATCAAGCCCTCTTCAACGGTGGCTCCACAGATGGATTGGTGAAGGCTTATAGTTCAAATGCTAAGGCTTTTTGGGCTGATTTTGCTAAGTCTATGGTTAAGAT
GGGGAATATAAACGTTTTGACTGGAAAGCAAGGCCAAGTTCGTTTGAATTGTAGGAAGGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCTCGTACCATCTTCTGTCTTTCTGCCTTCCTTGTGCTTTTGGTTCTTGCTACTTCTGCTTCTTCTTCAAAAGTACTATCTCCATATTACTATAACCATGTGTGTCCCAAAGCT
TTAGCAACTATCAAACGAGTTGTGGAGGCTGCAGTTTACAAAGAAAGACGCATGGGTGCTTCTTTGTTGCGTCTACACTTCCATGATTGTTTTGTCAAT
GGTTGTGATGCATCAATTCTT
TTGGATTCAACATCCACCATTGACAGTGAAAAGAATGCGTTGCCTAATATCAATTCTCTTAGAGGATTTGAAGTTATTGACCAAGTTAAGTCGGAGGTGGACAAAATCTGTGGACGTCCA
GTGGTCTCATGTGCAGATATCGTAGCTGTTGCAGCCCGGGACTCCGTCGTTGCG
CTAGGAGGGCCAACATGGGCCGTCCAACTAGGAAGGAAGGACTCAAACACAGCTAGCAGAGACAAA
GCCAACAATGACCTCCCATCACCATTCATGGATCTTCCTGCCCTAATCAACAACTTCAAAAGGCAGGGTTTAAATGAGAGAGACCTTGTAGCTCTCTCCGGAGGCCACACTTTAGGGTCA
GCACAGTGTTTTACGTTCAGAAACAGAATCCACAATGAAACAAATATCGACCCTAAATTTGTTAAACAGCGCAAACCAACATGTCCACTCGTTGGAGGTGACTCGAACCTTGCTCCTCTA
GACCCAACACCTGCACACTTTGATGTTGCATACTTCAACAGTTTGGTGAAGAAAAGAGGGTTGCTTCGCTCTGATCAAGCCCTCTTCAACGGTGGCTCCACAGATGGATTGGTGAAGGCT
TATAGTTCAAATGCTAAGGCTTTTTGGGCTGATTTTGCTAAGTCTATGGTTAAGATGGGGAATATAAACGTTTTGACTGGAAAGCAAGGCCAAGTTCGTTTGAATTGTAGGAAGGTGAAC
TAA

Retrieve as FASTA