Entry information : PtPrx80 (POPTR_0009s10960 / Potri.009G106400)
Entry ID 3175
Creation 2006-05-24 (Claudia Cosio)
Last sequence changes 2010-06-17 (Marie Brette (Scipio))
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx80 (POPTR_0009s10960 / Potri.009G106400)
Name (synonym) PtPrx80 (POPTR_0009s10960 / Potri.009G106400)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx80
start..stop
S start..stop
PtrePrx02 576 0 1..337 1..337
PtPrx70 572 0 1..337 1..337
RcPrx31 496 3e-178 1..337 1..335
PpePrx08 493 2e-177 1..337 1..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9256685..9256930 246 N° 2 9256010..9256201 192 N° 3 9255741..9255906 166 N° 4 9254981..9255390 410
complement(join(9254981..9255390,9255741..9255906,9256010..9256201,9256685..9256 930))


exon

Literature and cross-references PtPrx80 (POPTR_0009s10960 / Potri.009G106400)
Literature DOE joint genome institute.
DNA ref. Phytozome 12:   scaffold_9 (9256930..9254981)
Omic ref. ePlant:   Potri.009G106400
Protein sequence: PtPrx80 (POPTR_0009s10960 / Potri.009G106400)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337 (312)
PWM (Da):   %s   36741.23 (33927.7) Transmb domain:   %s   i5-27o
PI (pH):   %s   6.87 (6.27) Peptide Signal:   %s   cut: 26 range:26-337
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKTLFSYFTIPLFLCLSSLHLVTSFPFGSGQIDYNYNYNYYDRSCPRLGMIVKYGVWAAFKNDTRIAASLLRLHFHDCFVNGCDASILLDDTIDFRGEKNAFPNRNSVRGYEVIESIKADVENACSSTVSCADILTLAARESVLLSGGPYYPLSFGRRDGLTASEKAANEQLPSPIEPLENITAKFTSKGLDMKDVAVLSGAHTIGFAQCFTFKRRLFDFKGTGKPDPTLESLALTNLQGMCPNKDASNSNLAPLDYASTYRFDNAYYVNLVNSTGLLESDQALMGDPRTAALVTAYSSNSYLFSADFASSMTKLSNLGILTGSNGQIRKKCGSVN

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAAGACACTCTTCTCATACTTCACCATTCCCTTGTTTCTTTGCTTGTCTTCGCTTCACTTAGTCACTTCCTTCCCTTTTGGTAGTGGTCAGATTGATTACAATTACAACTACAAT
TACTATGACAGGTCATGCCCCCGTTTGGGAATGATTGTTAAGTATGGTGTCTGGGCTGCTTTCAAGAATGACACCAGAATCGCTGCATCCCTCCTTCGATTGCATTTTCATGACTGCTTT
GTAAAC
GTAATACTACTTAATCCATTTCTCTCTTGTCACGGGGTCAATTTTCTCGGCAAAATTTCCGGCCCTTATGCGGCAGTCTAATCTTGCTAGACTCATTCTTTCGCTTACCTATTT
ACTTGTTGTGTTTGCTTATAACTAGCTTGTCCCACAAATCCAAGAGATTACCTACATTCTTTTAATGTTGTAAATAAGAGAAATACACAAATGAATATAAATAGAAACAAGCACACAAGT
TATTAACAGGAACCAATCTTAATCTTTTACTAACATAAAAGATATACACAAGTCCATCTGCGTGCACATTTATTCTGCCTTCAGAACCTGCAACTTGATTGCACCCTTAACATGGTTAGA
AATTGAGACTTACTGGATAGATAGAGATTGGATTTATTTCTCATGTTGGGTCAAAACTGAAGAGCAGGCTATAATACTATATGCACATGACTTGAAATTTATTGACCAACTTATATAATG
ATCTTATAGGGCTGCGATGCTTCGATACTTTTAGATGACACGATTGATTTCAGGGGAGAGAAGAATGCTTTTCCTAACCGTAATTCAGTTAGAGGATATGAAGTCATTGAAAGTATCAAG
GCAGATGTTGAAAACGCTTGCTCATCAACTGTTTCATGTGCTGATATATTGACTCTTGCAGCAAGAGAATCTGTCCTTTTG
GTACTAACATTGCTCATATTCTTTATTCATTCATCGTGC
TCCTACGACATATTCTATTCTTTGTTCTAAAATCTTTATCCATTTACTTCATTTTCTGGTTCAGTCAGGAGGGCCTTATTATCCTCTTTCATTTGGCCGAAGAGATGGATTGACAGCAAG
TGAGAAGGCAGCTAATGAACAATTGCCATCACCTATTGAACCACTAGAAAACATCACTGCTAAGTTCACATCAAAGGGTCTTGATATGAAGGATGTTGCAGTCCTCTCAG
GTTCTTGCCC
TTTTCACTCTCTGGTCATCGCTCTCGATTTTAAGCTGTCAATGGAGTGATGTTCTTGTTCAGATCACAATTCAGAACTTTTGATTCCATATATGCCTTGCATTCATAGAGCTTAAATTAT
AGCGACGAAGTTTGCGACACCTCTTCTTTTAATTGGTTTAGACGACCACATTTTGTCGTCATATATATTATCCATCGTTACCTTCTATAAATTTCTTAAGCTCGGGTTTTTGACGACGGA
ACTTTTGGCGACAGCACAACCCAATGAGCAGAACAGAACTTTTTTACTAATTTCTAATACCGTGGACACAAATAATTAATTAGTTTCTTGTTAATTACAGGAGCACACACCATAGGTTTT
GCTCAATGCTTTACCTTCAAGAGGAGGCTCTTTGATTTCAAAGGCACCGGCAAGCCTGACCCCACACTAGAATCTTTGGCCTTGACAAACTTACAAGGCATGTGTCCAAATAAGGATGCA
TCAAACAGCAATCTTGCTCCTCTTGACTATGCAAGCACATACCGATTTGACAATGCTTATTATGTGAACCTCGTGAACAGCACTGGCCTTCTTGAATCTGATCAAGCTCTGATGGGGGAT
CCAAGGACTGCTGCACTTGTTACTGCCTACAGTTCAAATTCGTATCTTTTCTCGGCTGATTTTGCATCATCAATGACGAAGCTTAGCAATCTTGGTATACTTACAGGGAGCAATGGGCAA
ATTAGAAAGAAATGCGGGTCTGTTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAAGACACTCTTCTCATACTTCACCATTCCCTTGTTTCTTTGCTTGTCTTCGCTTCACTTAGTCACTTCCTTCCCTTTTGGTAGTGGTCAGATTGATTACAATTACAACTACAAT
TACTATGACAGGTCATGCCCCCGTTTGGGAATGATTGTTAAGTATGGTGTCTGGGCTGCTTTCAAGAATGACACCAGAATCGCTGCATCCCTCCTTCGATTGCATTTTCATGACTGCTTT
GTAAAC
GGCTGCGATGCTTCGATACTTTTAGATGACACGATTGATTTCAGGGGAGAGAAGAATGCTTTTCCTAACCGTAATTCAGTTAGAGGATATGAAGTCATTGAAAGTATCAAGGCA
GATGTTGAAAACGCTTGCTCATCAACTGTTTCATGTGCTGATATATTGACTCTTGCAGCAAGAGAATCTGTCCTTTTG
TCAGGAGGGCCTTATTATCCTCTTTCATTTGGCCGAAGAGAT
GGATTGACAGCAAGTGAGAAGGCAGCTAATGAACAATTGCCATCACCTATTGAACCACTAGAAAACATCACTGCTAAGTTCACATCAAAGGGTCTTGATATGAAGGATGTTGCAGTCCTC
TCAG
GAGCACACACCATAGGTTTTGCTCAATGCTTTACCTTCAAGAGGAGGCTCTTTGATTTCAAAGGCACCGGCAAGCCTGACCCCACACTAGAATCTTTGGCCTTGACAAACTTACAA
GGCATGTGTCCAAATAAGGATGCATCAAACAGCAATCTTGCTCCTCTTGACTATGCAAGCACATACCGATTTGACAATGCTTATTATGTGAACCTCGTGAACAGCACTGGCCTTCTTGAA
TCTGATCAAGCTCTGATGGGGGATCCAAGGACTGCTGCACTTGTTACTGCCTACAGTTCAAATTCGTATCTTTTCTCGGCTGATTTTGCATCATCAATGACGAAGCTTAGCAATCTTGGT
ATACTTACAGGGAGCAATGGGCAAATTAGAAAGAAATGCGGGTCTGTTAACTAA

Retrieve as FASTA