Entry information : PtPrx99 (POPTR_0001s04840)
Entry ID 3245
Creation 2006-06-22 (Claudia Cosio)
Last sequence changes 2010-06-17 (Marie Brette (Scipio))
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx99 (POPTR_0001s04840)
Name (synonym) PtPrx99 (POPTR_0001s04840)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx99
start..stop
S start..stop
PnPrx01 666 0 1..343 1..343
PtPrx33 647 0 1..343 1..343
PtPrx11_Trichobel 644 0 1..343 1..343
PatrPrx24 637 0 1..343 1..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3715692..3715904 213 N° 2 3715412..3715603 192 N° 3 3715008..3715176 169 N° 4 3714460..3714917 458
complement(join(3714460..3714917,3715008..3715176,3715412..3715603,3715692..3715 904))


exon

Literature and cross-references PtPrx99 (POPTR_0001s04840)
DNA ref. Phytozome 12:   scaffold_1 (3715904..3714460)
EST ref. GenBank:   CV249715 [3' end]
Cluster/Prediction ref. JGI gene:   547662
Omic ref. ePlant:   Potri.001G011200
Protein sequence: PtPrx99 (POPTR_0001s04840)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343 (321)
PWM (Da):   %s   36473.98 (34187.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.18 (4.09) Peptide Signal:   %s   cut: 23 range:23-343
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHLSKAIVAAFFFVVLLGGTLAYGQLTPTFYDQTCPNVSSIIRNVITETLVSDPRIAASLIRLHFHDCFVNGCDGSLLLDNTDTIESEKEAAGNNNSARGFEVVDRMKALLESTCPATVSCADILTIAAEESVVLAGGPCWTVPLGRRDSTTASRAAANASLPAPFLPLDQLRESFTNVGLNNNSDLVALSGAHTFGRARCSTFDFRLYNFSSTGAPDPSLDTTLLAALQELCPQGGNESVITDLDPTTPDVFDSNYYSNLQGNRGLLQTDQELFSTPGADDLIALVNAFSANQTAFFESFVESMIRMGNLSPLTGTEGEIRLNCRVVNANLAGPDSMLVSSI

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 1 EST. Contig also contains PtPrx93. UniGene Pth.13397 compile PtPrx22 and PtPrx99 EST's.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTTTCTAAGGCTATAGTTGCAGCTTTTTTCTTTGTAGTTTTGCTTGGAGGAACATTGGCTTATGGCCAGCTTACTCCAACATTTTATGACCAGACATGTCCAAATGTGAGCAGC
ATTATCCGTAATGTCATTACGGAGACATTGGTATCCGATCCTCGGATTGCAGCCAGCCTCATCAGGCTCCACTTCCATGACTGCTTTGTTAAT
GTAATTGCTTTGAAACATCTTATATTG
CTTAATTATATTAAACCGTCTATCTAAGTTGTGATTCTCAAGTTTTTTATTTTATTTTCAGGGCTGTGATGGTTCGCTTTTGTTGGACAATACTGATACTATAGAGAGCGAAAAGGAAGC
CGCAGGGAACAACAATTCTGCAAGAGGTTTTGAAGTCGTTGATAGAATGAAGGCTTTGTTGGAGAGTACCTGTCCTGCTACTGTTTCCTGTGCTGATATACTCACTATTGCAGCTGAAGA
ATCTGTTGTCTTG
GTATCTTAAAATGATCCCTCAACCCCTCAAATTATAAAATAAATATCTTGTTGTCTAATTCTAGTCAAAGAACGTAGAACACAAATATCATAGTTTATCATAATTGA
ATGAAAGAAAGAAGCTGAGATTTACTTAATTTTTTACATGACTTTATGACGGTTTGGACAAAAGGAGTTAAGATAGAAAAACGTTAAGAGTTGAAAAGTACTAATTCCCTAACTATGCAT
GGTTGCAGGCAGGAGGTCCATGTTGGACAGTTCCATTAGGAAGAAGAGATAGCACAACAGCAAGCCGAGCTGCAGCAAATGCTTCCCTTCCAGCCCCTTTTTTACCCCTTGATCAACTCA
GAGAGAGCTTCACTAATGTCGGCCTTAATAATAATAGTGATTTGGTAGCTCTATCTG
GTAAGTATTGTTTGTCAGGCTCGACTCTAAACTGTAAAACTCTGTTATAATTGATTCTCCTTT
GATGCAATTTCCTTTTTATCTTCTCAGGTGCTCACACATTTGGGAGGGCACGATGTTCTACGTTCGACTTCCGATTGTATAATTTCAGCAGCACCGGTGCTCCTGACCCATCATTGGACA
CAACTCTTCTAGCAGCTCTTCAGGAATTATGTCCCCAAGGTGGAAATGAGAGTGTGATAACAGATCTTGATCCCACAACACCTGATGTCTTTGACAGTAACTACTACTCCAATCTGCAAG
GTAACCGAGGCCTGCTTCAGACTGATCAAGAACTGTTTTCAACTCCTGGGGCAGATGATCTCATTGCACTTGTTAACGCTTTCAGTGCTAATCAAACAGCTTTCTTTGAAAGCTTTGTGG
AGTCCATGATAAGAATGGGAAATCTCAGCCCTCTGACAGGAACTGAAGGAGAGATCAGATTGAACTGCAGGGTAGTCAATGCAAACTTGGCTGGGCCAGATAGCATGCTTGTTAGCTCAA
TTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTTTCTAAGGCTATAGTTGCAGCTTTTTTCTTTGTAGTTTTGCTTGGAGGAACATTGGCTTATGGCCAGCTTACTCCAACATTTTATGACCAGACATGTCCAAATGTGAGCAGC
ATTATCCGTAATGTCATTACGGAGACATTGGTATCCGATCCTCGGATTGCAGCCAGCCTCATCAGGCTCCACTTCCATGACTGCTTTGTTAAT
GGCTGTGATGGTTCGCTTTTGTTGGAC
AATACTGATACTATAGAGAGCGAAAAGGAAGCCGCAGGGAACAACAATTCTGCAAGAGGTTTTGAAGTCGTTGATAGAATGAAGGCTTTGTTGGAGAGTACCTGTCCTGCTACTGTTTCC
TGTGCTGATATACTCACTATTGCAGCTGAAGAATCTGTTGTCTTG
GCAGGAGGTCCATGTTGGACAGTTCCATTAGGAAGAAGAGATAGCACAACAGCAAGCCGAGCTGCAGCAAATGCT
TCCCTTCCAGCCCCTTTTTTACCCCTTGATCAACTCAGAGAGAGCTTCACTAATGTCGGCCTTAATAATAATAGTGATTTGGTAGCTCTATCTG
GTGCTCACACATTTGGGAGGGCACGA
TGTTCTACGTTCGACTTCCGATTGTATAATTTCAGCAGCACCGGTGCTCCTGACCCATCATTGGACACAACTCTTCTAGCAGCTCTTCAGGAATTATGTCCCCAAGGTGGAAATGAGAGT
GTGATAACAGATCTTGATCCCACAACACCTGATGTCTTTGACAGTAACTACTACTCCAATCTGCAAGGTAACCGAGGCCTGCTTCAGACTGATCAAGAACTGTTTTCAACTCCTGGGGCA
GATGATCTCATTGCACTTGTTAACGCTTTCAGTGCTAATCAAACAGCTTTCTTTGAAAGCTTTGTGGAGTCCATGATAAGAATGGGAAATCTCAGCCCTCTGACAGGAACTGAAGGAGAG
ATCAGATTGAACTGCAGGGTAGTCAATGCAAACTTGGCTGGGCCAGATAGCATGCTTGTTAGCTCAATTTGA

Retrieve as FASTA