Entry information : PtPrx101 (POPTR_0003s21600 / Potri.003G215000)
Entry ID 3248
Creation 2010-01-04 (Christophe Dunand)
Last sequence changes 2010-07-08 (Marie Brette (Scipio))
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-07 (Qiang Li)
Peroxidase information: PtPrx101 (POPTR_0003s21600 / Potri.003G215000)
Name (synonym) PtPrx101 (POPTR_0003s21600 / Potri.003G215000)
Class Class III peroxidase     [Orthogroup: Prx006]*
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx101
start..stop
S start..stop
HbPrx01 491 4e-176 1..348 1..346
PtPrx102 482 1e-172 1..348 1..343
PtPrx99 482 2e-172 1..348 1..343
PkPrx04 480 5e-172 1..348 1..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 19701571..19701786 216 N° 2 19701882..19702079 198 N° 3 19702185..19702353 169 N° 4 19702440..19702903 464
join(19701571..19701786,19701882..19702079,19702185..19702353,19702440..19702903 )


exon

Literature and cross-references PtPrx101 (POPTR_0003s21600 / Potri.003G215000)
DNA ref. Phytozome 12:   scaffold_3 (19701571..19702903)
Omic ref. ePlant:   Potri.003G215000
Protein sequence: PtPrx101 (POPTR_0003s21600 / Potri.003G215000)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (323)
PWM (Da):   %s   37374.39 (34643.0) Transmb domain:   %s   i7-24o
PI (pH):   %s   4.28 (4.19) Peptide Signal:   %s   cut: 26 range:26-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHLSKVMFVALFYAFFAGVAPLAYGQLTPTFYDETCPNVTSIIREIIEDTLLSDARIGASLIRLHFHDCFVDGCDASILLDNTDTIESEKEALPNNNSARGFDVIDRMKARLESSENCPGIVSCADILAIAAEESVVLAGGPSWAVPLGRRDGTTANRALANLSLPSPFETLDEIKAKFTAVGLNNNTDLVALSGAHTFGRSRCQFFTNRLYNLSDCSTNPPPDDTLNSTYLATLRDLCPCNGNGSVLADLDPTTPDGFDSNYFSNLLVGQGLLRSDQLLFSTPGADTVDIVNNFSANQTAFFESFVVSMTRMGNLSLLTGTQGEIRLNCRVVNGNSTGQNIMLVSSI

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTTTCTAAAGTTATGTTTGTAGCTTTGTTCTATGCGTTTTTTGCAGGAGTAGCACCATTAGCTTATGGTCAGCTTACTCCAACATTTTATGATGAAACGTGTCCGAATGTGACC
AGCATCATACGTGAAATCATTGAAGATACCTTGTTATCCGATGCTCGGATCGGTGCCAGCCTCATTAGGCTTCACTTCCATGACTGCTTTGTTGAT
GTAAATTTGCTATGATCATTCATT
TTTGTGTCTCCATTTCTCTGCTTTCTTATCAAAAAAGAGAGTTAAGATTTTGATTCTTTTTTTTCCTGCAGGGTTGTGATGCATCGATTTTGTTGGACAATACCGATACAATTGAGAGTG
AGAAGGAAGCTTTGCCAAACAACAACTCTGCAAGAGGTTTTGATGTTATTGATAGAATGAAAGCCAGATTGGAGAGCTCTGAAAATTGTCCTGGCATAGTTTCATGTGCTGATATACTCG
CAATTGCAGCTGAAGAATCTGTCGTTTTG
GTATGTTAAAATGGAGAAGAAATTGATCGTAACCTCAATTTATGTGTACATGTTTTTGTACTGTATGTACTATATTAATCTAGACTAACCT
ATGTATGGTTATAGGCTGGAGGTCCCTCATGGGCAGTTCCACTAGGAAGAAGAGATGGAACAACAGCGAACCGGGCTCTAGCAAATCTTTCCCTTCCGTCCCCCTTTGAGACCCTTGATG
AAATCAAAGCCAAGTTCACTGCTGTTGGCCTGAATAACAATACTGATCTGGTTGCTCTATCTG
GTAACGACTACTATTATTCCCCTTCCTGGAGAAAAGAAAAACAGAAAAATGTTTGCT
GACATTTTTCACATCTCTTGTCTTGACAGGTGCTCACACATTCGGACGGTCTCGATGTCAATTTTTCACAAACCGGTTGTATAATTTGAGTGATTGCAGTACCAATCCTCCACCAGATGA
TACATTGAACTCAACTTATCTAGCAACACTCCGGGACTTGTGCCCTTGTAATGGGAACGGGAGTGTGCTTGCTGATCTTGATCCTACAACACCTGATGGTTTTGATAGTAACTATTTCTC
CAATCTGCTAGTTGGGCAAGGCCTACTTCGGAGTGATCAACTACTGTTTTCGACTCCTGGGGCAGATACCGTTGACATTGTCAACAACTTTAGTGCAAATCAAACAGCTTTCTTTGAAAG
CTTTGTCGTTTCCATGACAAGAATGGGGAATCTCAGCCTTTTGACAGGAACACAAGGGGAAATCAGATTGAACTGCCGTGTAGTTAATGGAAATTCAACTGGACAAAATATTATGCTTGT
TAGCTCAATTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTTTCTAAAGTTATGTTTGTAGCTTTGTTCTATGCGTTTTTTGCAGGAGTAGCACCATTAGCTTATGGTCAGCTTACTCCAACATTTTATGATGAAACGTGTCCGAATGTGACC
AGCATCATACGTGAAATCATTGAAGATACCTTGTTATCCGATGCTCGGATCGGTGCCAGCCTCATTAGGCTTCACTTCCATGACTGCTTTGTTGAT
GGTTGTGATGCATCGATTTTGTTG
GACAATACCGATACAATTGAGAGTGAGAAGGAAGCTTTGCCAAACAACAACTCTGCAAGAGGTTTTGATGTTATTGATAGAATGAAAGCCAGATTGGAGAGCTCTGAAAATTGTCCTGGC
ATAGTTTCATGTGCTGATATACTCGCAATTGCAGCTGAAGAATCTGTCGTTTTG
GCTGGAGGTCCCTCATGGGCAGTTCCACTAGGAAGAAGAGATGGAACAACAGCGAACCGGGCTCTA
GCAAATCTTTCCCTTCCGTCCCCCTTTGAGACCCTTGATGAAATCAAAGCCAAGTTCACTGCTGTTGGCCTGAATAACAATACTGATCTGGTTGCTCTATCTG
GTGCTCACACATTCGGA
CGGTCTCGATGTCAATTTTTCACAAACCGGTTGTATAATTTGAGTGATTGCAGTACCAATCCTCCACCAGATGATACATTGAACTCAACTTATCTAGCAACACTCCGGGACTTGTGCCCT
TGTAATGGGAACGGGAGTGTGCTTGCTGATCTTGATCCTACAACACCTGATGGTTTTGATAGTAACTATTTCTCCAATCTGCTAGTTGGGCAAGGCCTACTTCGGAGTGATCAACTACTG
TTTTCGACTCCTGGGGCAGATACCGTTGACATTGTCAACAACTTTAGTGCAAATCAAACAGCTTTCTTTGAAAGCTTTGTCGTTTCCATGACAAGAATGGGGAATCTCAGCCTTTTGACA
GGAACACAAGGGGAAATCAGATTGAACTGCCGTGTAGTTAATGGAAATTCAACTGGACAAAATATTATGCTTGTTAGCTCAATTTAA

Retrieve as FASTA