Entry information : AtRboh02 (At1g09090 / AtRbohB / ATRBOHB-BETA)
Entry ID 3283
Creation 2007-02-05 (Christophe Dunand)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-09 (Achraf Jemmat)
Peroxidase information: AtRboh02 (At1g09090 / AtRbohB / ATRBOHB-BETA)
Name (synonym) AtRboh02 (At1g09090 / AtRbohB / ATRBOHB-BETA)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Plasma membrane
Tissue type Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtRboh02
start..stop
S start..stop
ThasRboh02 1314 0 16..843 47..899
ToriRboh01 1251 0 29..843 62..904
PandeRboh01 1247 0 12..843 46..905
CsRboh03 1246 0 16..843 39..889
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2932743..2933127 385 N° 2 2933284..2933443 160 N° 3 2933558..2933606 49 N° 4 2933696..2933809 114
N° 5 2933952..2934389 438 N° 6 2934549..2934935 387 N° 7 2935061..2935156 96 N° 8 2935268..2935383 116
N° 9 2935467..2935569 103 N° 10 2935644..2935717 74 N° 11 2935797..2936296 500 N° 12 2936386..2936495 110
join(2932743..2933127,2933284..2933443,2933558..2933606,2933696..2933809,2933952 ..2934389,2934549..2934935,2935061..2935156,2935268..2935383,2935467..2935569,29 35644..2935717,2935797..2936296,2936386..2936495)


exon

Literature and cross-references AtRboh02 (At1g09090 / AtRbohB / ATRBOHB-BETA)
Protein ref. UniProtKB:   Q9SBI0
DNA ref. Phytozome 12:   Chr1 (2932743..2936495)
Cluster/Prediction ref. Phytozome Gene 12:   19656244 UniGene:   At.42241
Omic ref. AtProteome:   At1g09090 ATTED-II:   At1g09090 e-FP Browser:   At1g09090 ePlant:   At1g09090 Genevestigator:   At1g09090 TAIR:   At1g09090
Protein sequence: AtRboh02 (At1g09090 / AtRbohB / ATRBOHB-BETA)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   843
PWM (Da):   %s   96181.62 Transmb domain:   %s   o298-317i383-402o440-459i480-502o512-529i663-680o
PI (pH):   %s   9.59
Sequence 884
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MREEEMESSSEGETNKISRCKATGSDNPDEDYVEITLEVRDETINTMKAKATLRSVLSGRLKTMVKSLSFASRRLDRSKSFGAMFALRGLRFIAKNDAVGRGWDEVAMRFDKLAVEGKLPKSKFGHCIGMVESSEFVNELFEALVRRRGTTSSSITKTELFEFWEQITGNSFDDRLQIFFDMVDKNLDGRITGDEVKEIIALSASANKLSKIKENVDEYAALIMEELDRDNLGYIELHNLETLLLQVPSQSNNSPSSANKRALNKMLSQKLIPTKDRNPVKRFAMNISYFFLENWKRIWVLTLWISICITLFTWKFLQYKRKTVFEVMGYCVTVAKGSAETLKFNMALILLPVCRNTITWLRTKSKLIGSVVPFDDNINFHKVVAFGIAVGIGLHAISHLACDFPRLLHAKNVEFEPMKKFFGDERPENYGWFMKGTDGWTGVTMVVLMLVAYVLAQSWFRRNRANLPKSLKRLTGFNAFWYSHHLFVIVYVLLIVHGYFVYLSKEWYHKTTWMYLAVPVLLYAFERLIRAFRPGAKAVKVLKVAVYPGNVLSLYMSKPKGFKYTSGQYIYINCSDVSPLQWHPFSITSASGDDYLSVHIRTLGDWTSQLKSLYSKVCQLPSTSQSGLFIADIGQANNITRFPRLLIDGPYGAPAQDYRNYDVLLLVGLGIGATPLISIIRDVLNNIKNQNSIERGTNQHIKNYVATKRAYFYWVTREQGSLEWFSEVMNEVAEYDSEGMIELHNYCTSVYEEGDARSALITMLQSLHHAKSGIDIVSGTRVRTHFARPNWRSVFKHVAVNHVNQRVGVFYCGNTCIIGELKRLAQDFSRKTTTKFEFHKENF

Retrieve as FASTA  
Remarks Complete sequence from 4 cDNA, 7 ESTs and DNA. Four TREMBL accessions: Q9SBI0, Q84TJ9 (3' end is missing, frame shift), O04021 (3'end is missing, uncorrect splicing) and O04020 (5'end is missing, uncorrect splicing). O04021 and O04020 are related to the same BAC.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCAAGATCAT ATACGAGAAT GTTTGACTCC CCACCTTTTT TGTCTAAACC ATAAGCTATG GCAGCACCCG TTGGCTCATT GATTATACGA ACCACGTTAA GCCCCGCGAT TGCCCCTGCA  TCCTTTGTGG CTTGCCTCTG CGCATCATTG AAATACGCTA CAAAACAACC AAGAAGCAAG ACAAGCATTC TCATTATCAA TACATTCAAG GTGCTACACA CTTATACTTT AAACAGACTA  AACCGTTGCG GACTGGTGTT TTGGTTTCTT CTCAAAAACT TCTGAATAGA CTAATCCGTA TCCGTTTAAA GTATATTAAC ACATACCTGG AACCGTGATC ACAGCATCTT TAATCTTCTT  TCCCAAGAAA GCTTCAGCTG TTTCTTTCAT CTTGGTTAGT ATCATAGCAC TTATTTCCTC AGGGCTAAAC AATTTCTCTT CACCTTTAAC CTTCACTTGA ATGTAAGGCT TCCCATCTTT  GTTCACAACC TTGTATGGCA AGAATTTGAT ATCCCTTTGT ACATCAGGAT CATCAAATCT GTAACACAAC ACCCAAAAAA CATAAACAAA AAGCTCAAGA TATATTATAT ATGGACTAGA  CAGACACTAT GACACTAATT ACTAAACACT TACTTTCTTC CAATCAGACG TTTCGGGTCG AAGATGGTTC GCTCCGGGTT CTTGGCTGCT TGATTCTTAG CAGCTTCCCC GATGAGACGT  TCGGTATCAG TAAATGCAAC CCAAGATGGT GTAATTCTGT TTCCTTGATC GTTTGCTATG ATTTCCACAT GTTTGTTATG ATAGACACCA ACACATGAAT ATGTAGTCCC TAGATCGATC  CCTATCACCG TCCCCAGTTT CTGCTCTTCG CCTTCTATTG CCAAACTTGA CATCAAAGCT GCTCCAATAT TCATTAAAAA ATCAAGCACT ATAGCATAAA TAGGAGAAAC GTCAAATTCC  AAAAAATGTG TGTTTTATGA GAATTTTACC AGTCAGAAAA ACCAAACACG CAATAGCTTT GTTCCTCGTC ATCTTCGCTG TGTTTTCCTT GATAAAAATC ATTTTTCGTT GTTGAGAACT  CTTCTTCGAT CTCGTTTGTT AGTTTATTTG GAAGAGTATG AAGTTCGTCG TCTATTTATA TGTGCTTCAG TATGATTCGT ATTTAGCCTC GGTAGAGTGT CCTCTCCAAT CACTTCTTGA  CACGTAAGCT TAATGGGTTA TTTTGTGTTG GCGCGCTCCT TACTTTTTAC ACACGTAAAG TACCCAATCA CAAGCAGACA CGTGACATTA AATCGTCATC GCAAAATCTT TCAAAGGTTT  TACGACTTCT TCGTATGTAT GTATAGTTAT CCAAAACAAT TATCATTATA ATCAAAATTA AATTATTAAC AATGTTTTTA TCACATGCAT GAATTATTAA AAGATTTTTT TCGTGTACCG  ATTAATAAAA TAAAAAGATT TGCGTCATAA TTTACATAAG GATAATTTCT TTTGTTATTA ATGAATTAGT GTAATGCCAA AACTACTGCA TATGCGGTGA GGTGTAATAT TTGGAAGAAC  ATGACTAATG CTTAACCACT CCATTTATTT ATCACGCAGA CATATATATA AGAAATATGC CATTTTCTAA TTACTCTCAG TGTTGTATTT GTATTGGAAT CAATGCACAA TAAGAATTGG  ATATTGGATA ACAACAAAAC AGGCAAACCA ACCCTAATGG CGGCCCTAGG TTTTTGGCTT CTAATATTAA TTCACTTTCA AAACTAAATA ATTGACCATA TATCATTTGA TTTTTAAAAT  ATGTCGTTGG AGTAAATCAA TATTTTAATA CTAAGTTATA ATTCATATGG TATACTCGAA ATTGTCAAAG GGTAATATGG ATATTATTAT TTTATTTTAT TTTTTGTTAG AAGGGTAATA 
TGGGCATTAT AATCCGTCTT TTTTGACATT ATATAAATTA CATAGTATAC AAAACAGCGT GAATAATGTA ATTGTAGTGA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTTCGATTCT ATTCATCCAT CAGACCATCA TTAGAAAATA ATAAGCAAAA TATGTCAAGC TGATATCTAT TATAATTATA ACCACACTTT GAAGGGGTTC TAGATTCAAA AGTTGAGACT  ACAACTTGAA GTTTTCTATA ATGTAAAGAG GAGAAAGAAG AGTGTACATA AAAGAGGACT TAGGCGTAGT AATTCAAGCT TGCTTTCTTC TTGGCTTGTA CTTGAATTAT ACCTTCATTG  AAATCCTCAT GGTTCACCTG CACACACATT TACCATTTCC TCCATATCAT CCACATCCTA AAGTTACAAC CACTAAGACG AAAGATATAT GCATACCTCA GTTGCATCCC GGCGCAGGGC  AAGCATACCC GCTTCAACAC ACACTGCTTT GAGTTGAGCT CCATTGAAAT CATCCGTTGA CCGAGCAAGC TCTTCAAAAT TGACGTCTGC ATTCACATTC ATTTTCCTTG AATGTATCTG  TAACCCCATC GCCAACATTA TGCAAAAACA AAACAGTACC CAAGATAAGT TATCCGCGGA ATACATAGAA AATCACAGCA AGACTTGTCT AAGTGCATGA AGCTCTCTAA TTTTAGCTTT  AAAACGACAT AGAAATAAAG AAAGAAAAAA GAAAAGATGC AGTAAAGGAT ACAGAACCTG TAAGATCCTG CCTCTAGCTT CTTCAGTGGG GTGCGGAAAC TCGATTTTAC GATCCAAACG  ACCAGAACGC ATAAGGGCAG GATCTAGTAT ATCAGCACGA TTTGTCGCTG CAATAACCTA AGTTTGTAAA ATTATGAGTT TTTCATGCCT TTCACTAAAT AAATAGACAT TTGCAGGGGT  AATATGAGGG GTAACAACCT TAATGCGATC ATCGCTGCTG AATCCATCAA GCTGGTTGAG CAGCTCCAAC ATTGTCCTTT GTACCTCACG GTCTCCACTA ACTTCGCTGT AAGCCAATTA 
AAAGTCAGCA TTAGTCATCA GAAAGAAAAT AAAATAGTTA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCGGGAGGAAGAAATGGAATCTTCGTCAGAAGGTGAGACAAACAAGATTTCCCGATGCAAAGCCACTGGTTCAGACAATCCTGATGAGGACTACGTCGAGATCACACTCGAAGTGCGAG
ACGAAACCATCAACACAATGAAGGCCAAGGCGACACTTCGTTCGGTTCTTTCCGGGAGGCTGAAAACGATGGTTAAGTCGCTATCGTTTGCTTCACGCCGGCTCGACCGTAGTAAGTCGT
TCGGTGCTATGTTTGCTCTTCGAGGGTTGAGGTTCATTGCCAAAAACGACGCCGTTGGTAGAGGCTGGGATGAGGTTGCAATGAGGTTTGATAAGTTGGCCGTTGAAGGGAAACTCCCTA
AATCCAAATTTGGACATTGCATAG
GTAAACAAAAAAACTTTAAATAATATACCTTTTTTGGTTTCATTTTTTTCTCTCTGTAATTTCACTGCAATACTCAACTTGTTTCTCATATACAGT
TTTGTTTTTTTATTACTTTTTTTTTAACTGAATTTTAAAAGAATTATTTCAACTAAATAGGAATGGTTGAATCTAGCGAATTTGTGAACGAGCTTTTTGAGGCGTTGGTCCGAAGGAGAG
GGACTACGTCATCGTCAATCACCAAAACTGAATTGTTTGAATTCTGGGAGCAGATCACAGGCAATAGTTTTGATGATAGGCTGCAAATCTTTTTTGATAT
GTAAGCATGATTTTATATTT
ATTTATAGTATTTTGACAAGTATAATGCATGATTATCATTTGTCATAAAATATGGTAAGTTGATTAGTTATCTCTTTGTGTTTATGTATATAAGGGTGGACAAAAATTTGGACGGACGTA
TTACAGGAGATGAGGTTAAGGAG
GTGAGGTATACCTTATTAAATTGATCTCAATTTCGTTATGGTCCTAATATAAAAATGTTACAATCTAAGTTGTTTCGGCTGAATTATAGATAATTGC
TTTAAGTGCTTCGGCTAACAAGCTATCAAAGATTAAAGAAAATGTAGATGAATATGCTGCCTTGATCATGGAAGAACTAGATCGCGACAACCTCGGATATATTGAG
GTTCGTTGTCTACT
ATCTAATGGTTACACTTGTTTAACATCACTATTAAAAACATGGTTAAATCCTTAAAATCAGTTGTAAATGTATTTGTTATATATTTCAATGTGTTTGAAAATATAGTTGAGCAATGGTTT
ACTTGCAGTTACATAACTTGGAAACATTGCTTCTCCAAGTTCCTAGCCAATCAAATAACAGTCCATCTTCCGCGAACAAACGTGCACTCAACAAGATGTTGAGCCAGAAGCTCATACCAA
CAAAAGATCGAAACCCGGTGAAAAGATTTGCTATGAATATATCATACTTCTTCTTGGAAAATTGGAAAAGGATTTGGGTGTTAACATTGTGGATATCCATTTGCATCACTCTCTTCACTT
GGAAATTTCTCCAGTATAAACGCAAAACCGTGTTCGAGGTGATGGGCTACTGTGTTACCGTGGCCAAAGGCAGTGCAGAGACCTTGAAATTCAACATGGCTCTCATTCTCTTGCCCGTTT
GTAGGAACACTATCACTTGGCTAAGGACCAAGTCCAAGCTTATTGGGTCTGTTGTTCCATTTGATGACAATATCAATTTCCACAAG
GTAAATTATGTATATTAATATATATCATATCTAT
ACACATTATATAATTTTCATTGTCCAATAATCCATGTTTTTTTTGTTGTTGTAGAAGAATACAAAAAGATATACGACTTTTGTAACAATATAATTTGGTTATGCTTAATCTTTATGTCCA
TGCAGGTTGTTGCATTTGGGATCGCGGTTGGAATAGGCTTGCACGCTATATCTCACCTGGCATGTGATTTCCCGCGTTTGCTGCATGCAAAAAATGTAGAGTTTGAGCCAATGAAAAAGT
TTTTCGGAGACGAGAGGCCTGAAAATTATGGATGGTTCATGAAAGGGACAGACGGGTGGACCGGTGTTACCATGGTGGTTCTTATGTTAGTGGCCTACGTCTTGGCGCAGTCGTGGTTCA
GACGAAACCGGGCAAACCTACCAAAATCGTTGAAACGATTGACTGGTTTCAACGCATTTTGGTACTCACACCATTTGTTTGTCATCGTTTATGTTCTTCTCATCGTGCATGGCTATTTTG
TTTATCTCTCAAAGGAATGGTACCACAAGACG
GTACGTATACATATATTTTTTCTTGCGTCTTGATTAATCACGGAGTGTTCAGAAAATCAGACGAAAAGATCATATGATAATTTTTGTT
GATGAAAGCATCCTTTGTTATTATTACCTTTGGACAGACGTGGATGTATCTGGCAGTTCCCGTACTACTATATGCATTTGAACGATTGATTCGTGCATTTAGACCAGGTGCCAAGGCTGT
CAAGGTTTTGAAG
GTATTTCTATGATCTGTTCACAATAATATACATGCATTCTTGTTATTATAGACAAAAATCAAGGATATATTTCACTTTTTTAATTTCTATTGACATCAAACTGATTT
TCAGGTGGCAGTATATCCAGGAAATGTACTTTCACTTTACATGTCGAAGCCTAAAGGTTTCAAGTACACAAGTGGACAGTACATATATATTAACTGTTCTGACGTCTCACCATTACAATG
GTATATCAACAATACAATGCCACTGAACTTGTACAAGCATAAGATTTTAACTTTATTATTAACCTATTTTCAATTTTGTGTAGGCATCCGTTTTCAATTACTTCGGCTTCCGGGGATGAT
TACCTCAGCGTTCATATCCGCACACTCGGAGACTGGACATCGCAACTCAAATCCTTATATTCCAAG
GTTACTATTTTTCAAGAGTAACATTTGTGAATTAATGATATATGTACTTGATTT
GTTTAATTACAAAACCATAGGTTTGTCAACTTCCCTCAACAAGTCAAAGTGGGCTCTTCATAGCTGACATAGGTCAAGCCAACAATATAACCAGGTACAGTTTTTGATTTATAATTTGAG
TAATCATGATTTAAAAACATGAGCAATTTTTCTAATGAATTTTACATGGAAAGGTTTCCGAGGCTGTTAATCGATGGTCCATATGGTGCACCCGCACAAGATTACCGGAACTACGATGTA
TTGCTTCTAGTAGGTCTAGGGATCGGAGCGACGCCATTAATCAGCATAATCAGGGACGTCCTTAACAACATCAAGAACCAGAATTCCATCGAACGAGGCACTAACCAACACATAAAAAAC
TATGTTGCCACAAAACGAGCTTATTTTTATTGGGTAACAAGAGAGCAAGGATCATTGGAATGGTTCAGTGAGGTCATGAACGAGGTAGCTGAGTATGATAGTGAGGGGATGATTGAACTA
CATAATTACTGCACTAGCGTGTATGAGGAAGGAGATGCGAGGTCAGCACTAATCACCATGTTGCAGTCATTGCACCACGCCAAGAGCGGCATTGACATCGTATCGGGCACTCGGGTCCGA
ACCCATTTCGCTCGACCCAATTGGCGTAGTGTCTTCAAGCACGTCGCAGTCAACCACGTCAATCAACGAGTTG
GTATGTCACTAGCTATTACAACAATTCCATAGCTATTGTAGAATCTT
TCTAGTAAGTAACTGATTTTCCTTTTTCTATTTTGTTGGTAGGGGTTTTCTACTGTGGTAATACATGCATCATAGGAGAGTTAAAGAGACTGGCTCAAGATTTCTCTAGGAAAACTACGA
CCAAGTTTGAGTTCCACAAGGAAAATTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCGGGAGGAAGAAATGGAATCTTCGTCAGAAGGTGAGACAAACAAGATTTCCCGATGCAAAGCCACTGGTTCAGACAATCCTGATGAGGACTACGTCGAGATCACACTCGAAGTGCGAG
ACGAAACCATCAACACAATGAAGGCCAAGGCGACACTTCGTTCGGTTCTTTCCGGGAGGCTGAAAACGATGGTTAAGTCGCTATCGTTTGCTTCACGCCGGCTCGACCGTAGTAAGTCGT
TCGGTGCTATGTTTGCTCTTCGAGGGTTGAGGTTCATTGCCAAAAACGACGCCGTTGGTAGAGGCTGGGATGAGGTTGCAATGAGGTTTGATAAGTTGGCCGTTGAAGGGAAACTCCCTA
AATCCAAATTTGGACATTGCATAG
GAATGGTTGAATCTAGCGAATTTGTGAACGAGCTTTTTGAGGCGTTGGTCCGAAGGAGAGGGACTACGTCATCGTCAATCACCAAAACTGAATTGT
TTGAATTCTGGGAGCAGATCACAGGCAATAGTTTTGATGATAGGCTGCAAATCTTTTTTGATAT
GGTGGACAAAAATTTGGACGGACGTATTACAGGAGATGAGGTTAAGGAGATAATTG
CTTTAAGTGCTTCGGCTAACAAGCTATCAAAGATTAAAGAAAATGTAGATGAATATGCTGCCTTGATCATGGAAGAACTAGATCGCGACAACCTCGGATATATTGAG
TTACATAACTTGG
AAACATTGCTTCTCCAAGTTCCTAGCCAATCAAATAACAGTCCATCTTCCGCGAACAAACGTGCACTCAACAAGATGTTGAGCCAGAAGCTCATACCAACAAAAGATCGAAACCCGGTGA
AAAGATTTGCTATGAATATATCATACTTCTTCTTGGAAAATTGGAAAAGGATTTGGGTGTTAACATTGTGGATATCCATTTGCATCACTCTCTTCACTTGGAAATTTCTCCAGTATAAAC
GCAAAACCGTGTTCGAGGTGATGGGCTACTGTGTTACCGTGGCCAAAGGCAGTGCAGAGACCTTGAAATTCAACATGGCTCTCATTCTCTTGCCCGTTTGTAGGAACACTATCACTTGGC
TAAGGACCAAGTCCAAGCTTATTGGGTCTGTTGTTCCATTTGATGACAATATCAATTTCCACAAG
GTTGTTGCATTTGGGATCGCGGTTGGAATAGGCTTGCACGCTATATCTCACCTGG
CATGTGATTTCCCGCGTTTGCTGCATGCAAAAAATGTAGAGTTTGAGCCAATGAAAAAGTTTTTCGGAGACGAGAGGCCTGAAAATTATGGATGGTTCATGAAAGGGACAGACGGGTGGA
CCGGTGTTACCATGGTGGTTCTTATGTTAGTGGCCTACGTCTTGGCGCAGTCGTGGTTCAGACGAAACCGGGCAAACCTACCAAAATCGTTGAAACGATTGACTGGTTTCAACGCATTTT
GGTACTCACACCATTTGTTTGTCATCGTTTATGTTCTTCTCATCGTGCATGGCTATTTTGTTTATCTCTCAAAGGAATGGTACCACAAGACG
ACGTGGATGTATCTGGCAGTTCCCGTAC
TACTATATGCATTTGAACGATTGATTCGTGCATTTAGACCAGGTGCCAAGGCTGTCAAGGTTTTGAAG
GTGGCAGTATATCCAGGAAATGTACTTTCACTTTACATGTCGAAGCCTAAAG
GTTTCAAGTACACAAGTGGACAGTACATATATATTAACTGTTCTGACGTCTCACCATTACAATG
GCATCCGTTTTCAATTACTTCGGCTTCCGGGGATGATTACCTCAGCGTTCATATCC
GCACACTCGGAGACTGGACATCGCAACTCAAATCCTTATATTCCAAG
GTTTGTCAACTTCCCTCAACAAGTCAAAGTGGGCTCTTCATAGCTGACATAGGTCAAGCCAACAATATAACCA
G
GTTTCCGAGGCTGTTAATCGATGGTCCATATGGTGCACCCGCACAAGATTACCGGAACTACGATGTATTGCTTCTAGTAGGTCTAGGGATCGGAGCGACGCCATTAATCAGCATAATCA
GGGACGTCCTTAACAACATCAAGAACCAGAATTCCATCGAACGAGGCACTAACCAACACATAAAAAACTATGTTGCCACAAAACGAGCTTATTTTTATTGGGTAACAAGAGAGCAAGGAT
CATTGGAATGGTTCAGTGAGGTCATGAACGAGGTAGCTGAGTATGATAGTGAGGGGATGATTGAACTACATAATTACTGCACTAGCGTGTATGAGGAAGGAGATGCGAGGTCAGCACTAA
TCACCATGTTGCAGTCATTGCACCACGCCAAGAGCGGCATTGACATCGTATCGGGCACTCGGGTCCGAACCCATTTCGCTCGACCCAATTGGCGTAGTGTCTTCAAGCACGTCGCAGTCA
ACCACGTCAATCAACGAGTTG
GGGTTTTCTACTGTGGTAATACATGCATCATAGGAGAGTTAAAGAGACTGGCTCAAGATTTCTCTAGGAAAACTACGACCAAGTTTGAGTTCCACAAGG
AAAATTTCTAG

Retrieve as FASTA