Entry information : AtRboh04 (At5g47910 / AtRbohD)
Entry ID 3286
Creation 2007-02-05 (Christophe Dunand)
Last sequence changes 2015-06-04 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-09 (Achraf Jemmat)
Peroxidase information: AtRboh04 (At5g47910 / AtRbohD)
Name (synonym) AtRboh04 (At5g47910 / AtRbohD)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Plasma membrane
Tissue types Buds
Leaves
Mixed tissues
Roots
Seeds
Siliques
Whole plant
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtRboh04
start..stop
S start..stop
AlyRboh04 1842 0 1..921 1..920
ThasRboh04-2 1575 0 3..921 1..945
ThasRboh04-1 1509 0 3..921 1..929
PtRboh04 1406 0 18..921 8..926
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 19397585..19398212 628 N° 2 19398305..19398467 163 N° 3 19398661..19398709 49 N° 4 19399055..19399168 114
N° 5 19399610..19400419 810 N° 6 19400518..19400613 96 N° 7 19400761..19401556 796 N° 8 19401659..19401768 110
join(19397585..19398212,19398305..19398467,19398661..19398709,19399055..19399168 ,19399610..19400419,19400518..19400613,19400761..19401556,19401659..19401768)


exon

Literature and cross-references AtRboh04 (At5g47910 / AtRbohD)
Literature Torres M.A., Onouchi H., Hamada S., Machida C., Hammond-Kosack K.E., Jones J.D. Six Arabidopsis thaliana homologues of the human respiratory burst oxidase (gp91phox). Plant J. 14:365-370(1998).
Protein ref. UniProtKB:   Q9FIJ0
DNA ref. Phytozome 12:   Chr5 (19397585..19401768)
Cluster/Prediction ref. Phytozome Gene 12:   19668120 UniGene:   At.23270
Omic ref. AtProteome:   At5g47910 ATTED-II:   At5g47910 e-FP Browser:   At5g47910 ePlant:   At5g47910 Genevestigator:   At5g47910 TAIR:   At5g47910
Protein sequence: AtRboh04 (At5g47910 / AtRbohD)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   921
PWM (Da):   %s   103695.49 Transmb domain:   %s   o377-396i516-538o558-580i738-755o
PI (pH):   %s   9.68
Sequence 962
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKMRRGNSSNDHELGILRGANSDTNSDTESIASDRGAFSGPLGRPKRASKKNARFADDLPKRSNSVAGGRGDDDEYVEITLDIRDDSVAVHSVQQAAGGGGHLEDPELALLTKKTLESSLNNTTSLSFFRSTSSRIKNASRELRRVFSRRPSPAVRRFDRTSSAAIHALKGLKFIATKTAAWPAVDQRFDKLSADSNGLLLSAKFWECLGMNKESKDFADQLFRALARRNNVSGDAITKEQLRIFWEQISDESFDAKLQVFFDMVDKDEDGRVTEEEVAEIISLSASANKLSNIQKQAKEYAALIMEELDPDNAGFIMIENLEMLLLQAPNQSVRMGDSRILSQMLSQKLRPAKESNPLVRWSEKIKYFILDNWQRLWIMMLWLGICGGLFTYKFIQYKNKAAYGVMGYCVCVAKGGAETLKFNMALILLPVCRNTITWLRNKTKLGTVVPFDDSLNFHKVIASGIVVGVLLHAGAHLTCDFPRLIAADEDTYEPMEKYFGDQPTSYWWFVKGVEGWTGIVMVVLMAIAFTLATPWFRRNKLNLPNFLKKLTGFNAFWYTHHLFIIVYALLIVHGIKLYLTKIWYQKTTWMYLAVPILLYASERLLRAFRSSIKPVKMIKVAVYPGNVLSLHMTKPQGFKYKSGQFMLVNCRAVSPFEWHPFSITSAPGDDYLSVHIRTLGDWTRKLRTVFSEVCKPPTAGKSGLLRADGGDGNLPFPKVLIDGPYGAPAQDYKKYDVVLLVGLGIGATPMISILKDIINNMKGPDRDSDIENNNSNNNSKGFKTRKAYFYWVTREQGSFEWFKGIMDEISELDEEGIIELHNYCTSVYEEGDARVALIAMLQSLQHAKNGVDVVSGTRVKSHFAKPNWRQVYKKIAVQHPGKRIGVFYCGMPGMIKELKNLALDFSRKTTTKFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic, 4 cDNA and 23 ESTs. Two TREMBL accessions Q9FIJ0 and O81212.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AATTTTGATA GCAGTGGAGA TAAGTCAAAG GTTCGTCTTC TAATTAATTA ACAGCGATTA TTAGACTATC TAACTTTTCT TCTTTTCTTA TTTTGATAAT AACTATATAT CTTCTTTAGC  CACCTTACTT TCTCATCGGG TTCTATTTAA ATAGGGACAA AGAAAACAAA CCATCGATTT GTACTATGTG CTCAATTATA TCATATGTTT TGTCTCCATC TATGTATCTA TTTCTCTTTT  CCATTTGGTA AATTATTTAA GACCCTTAAA CTGACTTTTC TCGTGGGCGG CGTCGAAGTT TTGGTTAACA GACAAAACAT CTGTTCATGA TGCCTGCATA ACTCTATGTT TTTATACTAC  TCATTTGCCC TCTATTTCAT GCTACTCTTA AAAATAGCTA AATAAAAATA CTTCAATATT AGAAAAAAAA TCTTCTTGAT GTCAAAAATA CACTTTAGAT ATCCCCTCTA GTTCTTGTGA  TGCTAATATA TTACAAAATT GTTTATATAT ATAGAAATAT TACCTCTAGC AATACAAAAA TCTTGTTATA TCAATTAAAT ATAACACTAT CCGACTAGTG TTTACTAAAA TAACACATAA  TTTTTAATTA TGATCTTTGA ATTTTAGTTT ATGTATTACG CTTTATAATT TTGTTATCAA AAACTATAAA AGCTCAAAAG TGAGCATCTA TACCCTAATT CCGTTTTTAT GCATACACTT  AGGTTTATTT TTATTACGAG AATCTGTGTT TAGTATATAT AAAATAGAGT TTATGAATGA CTAAGTTAAA TACTTCAATA CTAATTAAAG TAAGTCGTAT TGATGCAGAC AATATAAACT  TTAGATATCT CCGCTAGTTT GTATAATGCT AATAGATTCA AATTGTCTTT ATGTAGAGGA ATTACCTCAA ATAACATAAA ATTTTCATTT TATTAATTAA ATCTCATTTT GTCATTTCAA  AAGTCATTTT AATTACTGTG TTATTTGTCT AAAGTATACT CCAAACAAGA AACCAAAGTA GAAGGTCAGT GCCCAAGAGA CAAATAAACT TAAGCATGTC CACTCTTTTT AGCGATCGGA  TCGCTTATCT GTTCTTATCC ATTATGGAAC ATGAACGATG TTCCTTTAAG ACTACCACAT TCAAACGAAA AATAAGTCAT CGATGATAGA CTGGATAGTT ATAGTTTGAT GATCTAGCTA  ATTGACTTTC ATATTTACAT AAAACAGAAA TGTGTTTTTA TCAAAAAAGA AAAAAGAAAA AACAGAAAAT GAACAATACA TCTCACATGG AGTTTGTACA AGAATCCATA ATAATTTTTT  GTTCGGTACA GTAGGTTAGA TATACATTTG AATACAGTTT ACAAGCCAAA TGTTAGAAGC AACATATTTA TATAGTATCA TCAATATACG ATCCAAAATG AATTATAGAT TGACTTATGG  AAAAGTTAGA TACTATATGC ATGATTGCCA AATACATTGA AAAATAACAA TTTAAGTTCT TCAAACAAAA GTTTATAAAT GACTCGGTGT TTGACATAAC TCGGGGTTGT TTTTCTTTGT  TAATTCACAC ACGGGGTTGG TGTATAAATG ACTTCGGTGT TTGAAATGTA TGACACGGTA TAAATAAAAA AGGTAAGGAA GAAATGAAGA ATAGAAGAAG AACAAAAAAA AAAGGAAATT  AAAAAAAAGT CAAAATAAAT GGTCAGTAAA GGATTTTGAC CAGACCGGAG CGGTCCATCC ATAGTTTCCC ACTACCTTCC CTGATTTAGC ACAGAAGAAT GGCAATTTGC ATGCCATTTA  TTTCATCTAT TCCTCCTTCA CTCTATAAAT ATATTTTAAA CAAAATCAAT TTCTTCCATA CACAAAAATC AAACACCTTT TGAGAGCGGT TATTTTTTCT CTATCAACTA ATACAGTAAC 
CTTACGGGTG TTTATTTGTA TAGATCTCTG TGGTTTTCTT GGCCAAATCT AGTGAGATCT TTTTGGTTTC TCGAATTCG 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTAATTATA TACGTTGTAG AAAAATAAAA CAAGAAACAA CTATACAAAT AAATATTTAT TTTAAATTCT TTTCATTTTT ATGTAAAATT ATCTGAGTTA TCTTTTTTTG TTCTTCTATA  TCCCTACCGT TTTGTTGGTT ACTTTTTCAC TACTTAGTTT AATGCCAAAT TAAGTATAAG ATAGTAGAAG TTTATATAGT TACAGCTTTG GTGTTGTAAA CATGTAATCA TGGAGTTATC  TGTACTATTA TTTTGTACTT ATATTCGAAT ATTAACAACT AAAGATAGTT TTGATATTCA ATACCCATTA CTCATTTAAC ATAATGAATA GAGATATCAA CATTAGATAC GTCTTGATTA  TTTGCTCACC AATGCATTTG CGTGTTTAAC TTGTTTATAT GTTATTAATA GTGTTCTTTT AGTTAAAATG ACAAATAATT TCTTAACTCA AAAGCATCTT ATATCACAAC TCTAGCTAGA  TTAGTTTAGC TTTTCATAAG TCTTCTTGCG TTTACGTCTT TATTTATGGG TTGATACCCT ATTCACTACT TTAATTTGCC TTGCACTTGG GATAGTTTAA AAGACTTTAA AATTATGCAG  CTAGAATATA ATCAAAACTT GATATAAGTA TCAAAATAAT TAAATACAAT TGCTATCGAT AATAATCAGA AACAATCGTT ATGAATGGTT AAGTTTGTTT CCTTAAAATG GTTACGAATG  ATTAATTTTG TTCCTTAGGT AAACTAAAAG TTCAAAAACA AATCCAACCT ACTACAATCT AAGAAAACTG ACAAAGTTTA TGGTTGATTA CAGAATAGGT CGCTTGAGCG TCAAATTAAG  ATAAAGAAGG AGACTTATGT AGAGCCGGCC CTTGGGCCAA CCAGGCGAAG CATAGGTTTG CAGCTGCTAA TAATATAATT TGAGTTTGGC TTTTTTCTAG AAAACTTTCT TTAAGTCTAG 
TGGTTCAATT ATGGTGGGTA CATCATCAGT TCATGGGTTT 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAAATGAGACGAGGCAATTCAAGTAACGACCATGAACTTGGGATTCTACGAGGAGCTAACTCGGACACCAACTCGGACACGGAGAGCATCGCTAGCGACCGTGGTGCCTTTAGCGGTC
CGCTTGGCCGGCCTAAACGTGCGTCCAAGAAAAACGCAAGATTCGCCGACGATCTTCCCAAGAGAAGCAATAGTGTTGCTGGCGGCCGTGGTGATGACGATGAGTACGTGGAGATCACGC
TAGACATCAGGGACGACTCGGTGGCCGTCCATAGTGTCCAACAAGCAGCTGGAGGTGGAGGCCACCTGGAGGACCCGGAGCTAGCCCTTCTTACGAAGAAGACTCTCGAGAGCAGCCTCA
ACAACACCACCTCCTTATCTTTCTTCCGAAGCACCTCCTCACGCATCAAGAACGCCTCCCGCGAGCTCCGCCGCGTGTTCTCTAGACGTCCCTCCCCGGCCGTGCGGCGGTTTGACCGCA
CGAGCTCCGCGGCCATCCACGCACTCAAAGGTCTCAAGTTCATTGCCACCAAGACGGCCGCATGGCCGGCCGTCGACCAACGTTTCGATAAACTCTCCGCTGATTCCAACGGCCTCTTAC
TCTCTGCCAAGTTTTGGGAATGCTTAG
GTAAGTAAATCACTTCTTACTAAGCAATTCTATTAGTACTATATGTTTCCATTTTTGTGTTAGTCTCATTTTTGTTTTGTTTTTTACTCTAGG
AATGAATAAGGAATCTAAAGACTTCGCTGACCAGCTCTTTAGAGCATTAGCTCGCCGGAATAACGTCTCCGGCGATGCAATCACAAAGGAACAGCTTAGGATATTCTGGGAACAGATCTC
AGACGAAAGCTTTGATGCCAAACTCCAAGTCTTTTTTGACAT
GTAAGCTTTTTTTTACATATCTTCACCTAACCCACAATAAATATATAACGCGTAATCACTATTTGTCGTTTAATATTG
ACTCTTAATGAAAATTAAACGGTCATCAGAATTTAAGGACCAAAAGTAGTAATATTAATCATTTGTGGAGTTTTGGTGGATTTGTAACTAATATATGACATCACTGTTTGGTCAGGGTGG
ACAAAGATGAAGATGGGCGAGTAACAGAAGAAGAGGTGGCTGAG
GTGAGAAAACACACACACCACTCAATAATTATCTTTTTCAAATATTTTATTATATTTATACATTTTTTTTATCTTA
TATTTATTCATATTCCTGGTTGAATTTTTTTTCTCTTATTTTATACGTTATTCTTGGTTGATTATTTTGACAATTTTGTCCACGCGCAAATCCCCACTGACTTTATCTGCTGACGTTTAC
TATTAACATCATCAATATATTAACTTCATGTGAACACGACAAAATGGTAATAGATAGATAGAGTAGTAGTCTTTGTTACTTTAGCTTAGGTTATTAATGTTTCAAATACTTTAGCTTTTG
TTTTCTAATTTGTTGGTAATTTATTGCAGATTATTAGTCTTAGTGCTTCTGCAAACAAGCTCTCAAATATTCAAAAGCAAGCCAAAGAATATGCGGCACTGATAATGGAAGAGTTGGACC
CAGACAATGCTGGGTTTATTATG
GTACGTGTGGTCCACTTTCACCCACTCAATCACACTAATGGTATTATGTACGTCGTAAATTTAACCACTCTTAAAATACTAGAAAAAACGTGGAAAA
ACATAACGTTCTAGAAGTCTTTAGTGGTCAAAATTGGGTCACCATGATGTTTTTTAATTTCCAACTTATTGGGCCATCTTGAACTTTTTACCAAACCAATCAACAAAATCTCGACAATGG
GTGGTTAGTGGTTACGATATGAAGAAATGACCAATAAAATTGTAAAATATATGAACTAACACTATAATCCAAGCTTAGAAAGTCTTAGGCGGCTTCCGATAGTATATTGTTTTTTAATTA
TTGGAGAAACCTATGAAAAGTGTTTTTAAGAAAAACAGTTTGGAACATTAATGTTTTATTGTAACGTTTTAGTTAATTATATGATATGGACATTGGTGAAACAGATCGAAAACTTGGAAA
TGTTGCTATTACAAGCACCAAACCAGTCGGTGCGGATGGGAGACAGCAGGATACTTAGTCAGATGTTAAGTCAGAAGCTTAGACCGGCAAAAGAGAGCAACCCTTTAGTGAGATGGTCGG
AGAAAATCAAATATTTCATACTTGACAATTGGCAGAGACTATGGATAATGATGTTATGGCTTGGCATCTGTGGTGGCCTCTTTACTTATAAATTCATTCAGTACAAGAACAAAGCTGCCT
ATGGTGTCATGGGTTATTGCGTTTGTGTCGCCAAAGGAGGCGCCGAGACTCTCAAATTCAACATGGCTCTCATATTGTTGCCTGTTTGTCGAAACACCATCACTTGGCTTAGGAACAAGA
CTAAGCTTGGTACTGTCGTTCCTTTTGATGATAGTCTTAACTTCCACAAGGTTATTGCAAGCGGGATAGTCGTCGGTGTTTTACTCCATGCGGGTGCCCATTTAACGTGTGATTTTCCAC
GTTTAATTGCCGCGGATGAGGACACCTATGAGCCGATGGAAAAATACTTTGGGGATCAACCGACTAGCTACTGGTGGTTTGTGAAAGGAGTGGAAGGATGGACTGGCATTGTGATGGTTG
TGCTAATGGCTATAGCCTTTACACTCGCGACGCCTTGGTTCCGACGTAACAAGCTTAACTTACCTAACTTCCTCAAGAAGCTTACCGGTTTCAACGCCTTTTGGTACACCCACCATTTGT
TCATCATTGTTTATGCTCTTCTCATTGTCCATGGTATCAAGCTCTACCTCACAAAGATTTGGTATCAGAAAACG
GTACTCTCTTCAAACCTCATTTTATCTGTTTTAATTTCTTATTTTC
TTTCCTTTTTCCGGTTAATAACATTTATTACCTGTTTGTATGATTCTTGTAGACATGGATGTATCTTGCTGTACCCATCCTTCTATATGCATCGGAGAGGCTGCTCCGTGCTTTCAGATC
AAGCATCAAACCGGTTAAGATGATCAAG
GTCAGATATATTTCTATTTATCTCTTGAAAACCTTATGTTTCAAGAAATATTTCAACTAATACTTTTAAACCATCTTATTTTATAGTTCTTT
TTGATAAAAGTTTGAAAATTGCCTTTGAACTTAATCTATATATATGTAACAACAGGTGGCTGTTTACCCCGGGAACGTGTTGTCTCTACACATGACGAAGCCACAAGGATTCAAATACAA
AAGTGGACAGTTCATGTTGGTGAACTGCCGAGCCGTATCTCCATTCGAATGGCATCCTTTCTCAATCACATCAGCTCCCGGAGACGATTACCTGAGCGTACATATCCGCACTCTCGGTGA
CTGGACACGTAAGCTCAGGACCGTTTTCTCCGAGGTTTGCAAACCTCCTACCGCCGGTAAAAGCGGTCTTCTCCGAGCAGACGGAGGAGATGGAAACCTCCCGTTCCCGAAGGTCCTTAT
CGACGGTCCATACGGTGCTCCCGCACAAGACTACAAGAAATACGACGTGGTACTCCTCGTAGGTCTCGGCATTGGAGCCACGCCTATGATCAGTATCCTTAAGGACATCATCAACAACAT
GAAAGGTCCTGACCGCGACAGCGACATTGAGAACAATAACAGTAACAACAATAGTAAAGGGTTTAAGACAAGGAAAGCTTATTTCTACTGGGTGACTAGGGAACAAGGATCATTCGAGTG
GTTCAAGGGAATAATGGACGAGATTTCGGAGTTAGACGAGGAAGGAATCATCGAGCTTCACAATTATTGCACGAGTGTGTACGAGGAAGGTGATGCAAGAGTGGCTCTCATTGCCATGCT
TCAGTCGTTGCAACACGCTAAGAACGGTGTGGATGTTGTGTCGGGTACACGTGTCAAGTCCCACTTCGCTAAACCTAACTGGAGACAAGTCTACAAGAAGATCGCTGTTCAACATCCCGG
CAAAAGAATAG
GTAACTAATCTCGACCGTTAATCTCGTTATGTACGTGATGTTGTATAATAATTAATAAAGTGATGAATTTAGACTAAATACTAATATGAATTTTGATTGCAGGAGTCTT
CTACTGTGGAATGCCAGGAATGATAAAGGAATTAAAAAATCTAGCTTTGGATTTTTCTCGAAAGACAACTACCAAGTTTGACTTCCACAAAGAGAACTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAAATGAGACGAGGCAATTCAAGTAACGACCATGAACTTGGGATTCTACGAGGAGCTAACTCGGACACCAACTCGGACACGGAGAGCATCGCTAGCGACCGTGGTGCCTTTAGCGGTC
CGCTTGGCCGGCCTAAACGTGCGTCCAAGAAAAACGCAAGATTCGCCGACGATCTTCCCAAGAGAAGCAATAGTGTTGCTGGCGGCCGTGGTGATGACGATGAGTACGTGGAGATCACGC
TAGACATCAGGGACGACTCGGTGGCCGTCCATAGTGTCCAACAAGCAGCTGGAGGTGGAGGCCACCTGGAGGACCCGGAGCTAGCCCTTCTTACGAAGAAGACTCTCGAGAGCAGCCTCA
ACAACACCACCTCCTTATCTTTCTTCCGAAGCACCTCCTCACGCATCAAGAACGCCTCCCGCGAGCTCCGCCGCGTGTTCTCTAGACGTCCCTCCCCGGCCGTGCGGCGGTTTGACCGCA
CGAGCTCCGCGGCCATCCACGCACTCAAAGGTCTCAAGTTCATTGCCACCAAGACGGCCGCATGGCCGGCCGTCGACCAACGTTTCGATAAACTCTCCGCTGATTCCAACGGCCTCTTAC
TCTCTGCCAAGTTTTGGGAATGCTTAG
GAATGAATAAGGAATCTAAAGACTTCGCTGACCAGCTCTTTAGAGCATTAGCTCGCCGGAATAACGTCTCCGGCGATGCAATCACAAAGGAAC
AGCTTAGGATATTCTGGGAACAGATCTCAGACGAAAGCTTTGATGCCAAACTCCAAGTCTTTTTTGACAT
GGTGGACAAAGATGAAGATGGGCGAGTAACAGAAGAAGAGGTGGCTGAGA
TTATTAGTCTTAGTGCTTCTGCAAACAAGCTCTCAAATATTCAAAAGCAAGCCAAAGAATATGCGGCACTGATAATGGAAGAGTTGGACCCAGACAATGCTGGGTTTATTATG
ATCGAAA
ACTTGGAAATGTTGCTATTACAAGCACCAAACCAGTCGGTGCGGATGGGAGACAGCAGGATACTTAGTCAGATGTTAAGTCAGAAGCTTAGACCGGCAAAAGAGAGCAACCCTTTAGTGA
GATGGTCGGAGAAAATCAAATATTTCATACTTGACAATTGGCAGAGACTATGGATAATGATGTTATGGCTTGGCATCTGTGGTGGCCTCTTTACTTATAAATTCATTCAGTACAAGAACA
AAGCTGCCTATGGTGTCATGGGTTATTGCGTTTGTGTCGCCAAAGGAGGCGCCGAGACTCTCAAATTCAACATGGCTCTCATATTGTTGCCTGTTTGTCGAAACACCATCACTTGGCTTA
GGAACAAGACTAAGCTTGGTACTGTCGTTCCTTTTGATGATAGTCTTAACTTCCACAAGGTTATTGCAAGCGGGATAGTCGTCGGTGTTTTACTCCATGCGGGTGCCCATTTAACGTGTG
ATTTTCCACGTTTAATTGCCGCGGATGAGGACACCTATGAGCCGATGGAAAAATACTTTGGGGATCAACCGACTAGCTACTGGTGGTTTGTGAAAGGAGTGGAAGGATGGACTGGCATTG
TGATGGTTGTGCTAATGGCTATAGCCTTTACACTCGCGACGCCTTGGTTCCGACGTAACAAGCTTAACTTACCTAACTTCCTCAAGAAGCTTACCGGTTTCAACGCCTTTTGGTACACCC
ACCATTTGTTCATCATTGTTTATGCTCTTCTCATTGTCCATGGTATCAAGCTCTACCTCACAAAGATTTGGTATCAGAAAACG
ACATGGATGTATCTTGCTGTACCCATCCTTCTATATG
CATCGGAGAGGCTGCTCCGTGCTTTCAGATCAAGCATCAAACCGGTTAAGATGATCAAG
GTGGCTGTTTACCCCGGGAACGTGTTGTCTCTACACATGACGAAGCCACAAGGATTCAAAT
ACAAAAGTGGACAGTTCATGTTGGTGAACTGCCGAGCCGTATCTCCATTCGAATGGCATCCTTTCTCAATCACATCAGCTCCCGGAGACGATTACCTGAGCGTACATATCCGCACTCTCG
GTGACTGGACACGTAAGCTCAGGACCGTTTTCTCCGAGGTTTGCAAACCTCCTACCGCCGGTAAAAGCGGTCTTCTCCGAGCAGACGGAGGAGATGGAAACCTCCCGTTCCCGAAGGTCC
TTATCGACGGTCCATACGGTGCTCCCGCACAAGACTACAAGAAATACGACGTGGTACTCCTCGTAGGTCTCGGCATTGGAGCCACGCCTATGATCAGTATCCTTAAGGACATCATCAACA
ACATGAAAGGTCCTGACCGCGACAGCGACATTGAGAACAATAACAGTAACAACAATAGTAAAGGGTTTAAGACAAGGAAAGCTTATTTCTACTGGGTGACTAGGGAACAAGGATCATTCG
AGTGGTTCAAGGGAATAATGGACGAGATTTCGGAGTTAGACGAGGAAGGAATCATCGAGCTTCACAATTATTGCACGAGTGTGTACGAGGAAGGTGATGCAAGAGTGGCTCTCATTGCCA
TGCTTCAGTCGTTGCAACACGCTAAGAACGGTGTGGATGTTGTGTCGGGTACACGTGTCAAGTCCCACTTCGCTAAACCTAACTGGAGACAAGTCTACAAGAAGATCGCTGTTCAACATC
CCGGCAAAAGAATAG
GAGTCTTCTACTGTGGAATGCCAGGAATGATAAAGGAATTAAAAAATCTAGCTTTGGATTTTTCTCGAAAGACAACTACCAAGTTTGACTTCCACAAAGAGAACT
TCTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATACACAAAA ATCAAACACC TTTTGAGAGC GGTTATTTTT TCTCTATCAA CTAATACAGT AACCTTACGG GTGTTTATTT GTATAGATCT CTGTGGTTTT CTTGGCCAAA TCTAGTGAGA  TCTTTTTGGT TTCTCGAATT CGATGAAAAT GAGACGAGGC AATTCAAGTA ACGACCATGA ACTTGGGATT CTACGAGGAG CTAACTCGGA CACCAACTCG GACACGGAGA GCATCGCTAG  CGACCGTGGT GCCTTTAGCG GTCCGCTTGG CCGGCCTAAA CGTGCGTCCA AGAAAAACGC AAGATTCGCC GACGATCTTC CCAAGAGAAG CAATAGTGTT GCTGGCGGCC GTGGTGATGA  CGATGAGTAC GTGGAGATCA CGCTAGACAT CAGGGACGAC TCGGTGGCCG TCCATAGTGT CCAACAAGCA GCTGGAGGTG GAGGCCACCT GGAGGACCCG GAGCTAGCCC TTCTTACGAA  GAAGACTCTC GAGAGCAGCC TCAACAACAC CACCTCCTTA TCTTTCTTCC GAAGCACCTC CTCACGCATC AAGAACGCCT CCCGCGAGCT CCGCCGCGTG TTCTCTAGAC GTCCCTCCCC  GGCCGTGCGG CGGTTTGACC GCACGAGCTC CGCGGCCATC CACGCACTCA AAGGTCTCAA GTTCATTGCC ACCAAGACGG CCGCATGGCC GGCCGTCGAC CAACGTTTCG ATAAACTCTC  CGCTGATTCC AACGGCCTCT TACTCTCTGC CAAGTTTTGG GAATGCTTAG GAATGAATAA GGAATCTAAA GACTTCGCTG ACCAGCTCTT TAGAGCATTA GCTCGCCGGA ATAACGTCTC  CGGCGATGCA ATCACAAAGG AACAGCTTAG GATATTCTGG GAACAGATCT CAGACGAAAG CTTTGATGCC AAACTCCAAG TCTTTTTTGA CATGGTGGAC AAAGATGAAG ATGGGCGAGT  AACAGAAGAA GAGGTGGCTG AGATTATTAG TCTTAGTGCT TCTGCAAACA AGCTCTCAAA TATTCAAAAG CAAGCCAAAG AATATGCGGC ACTGATAATG GAAGAGTTGG ACCCAGACAA  TGCTGGGTTT ATTATGATCG AAAACTTGGA AATGTTGCTA TTACAAGCAC CAAACCAGTC GGTGCGGATG GGAGACAGCA GGATACTTAG TCAGATGTTA AGTCAGAAGC TTAGACCGGC  AAAAGAGAGC AACCCTTTAG TGAGATGGTC GGAGAAAATC AAATATTTCA TACTTGACAA TTGGCAGAGA CTATGGATAA TGATGTTATG GCTTGGCATC TGTGGTGGCC TCTTTACTTA  TAAATTCATT CAGTACAAGA ACAAAGCTGC CTATGGTGTC ATGGGTTATT GCGTTTGTGT CGCCAAAGGA GGCGCCGAGA CTCTCAAATT CAACATGGCT CTCATATTGT TGCCTGTTTG  TCGAAACACC ATCACTTGGC TTAGGAACAA GACTAAGCTT GGTACTGTCG TTCCTTTTGA TGATAGTCTT AACTTCCACA AGGTTATTGC AAGCGGGATA GTCGTCGGTG TTTTACTCCA  TGCGGGTGCC CATTTAACGT GTGATTTTCC ACGTTTAATT GCCGCGGATG AGGACACCTA TGAGCCGATG GAAAAATACT TTGGGGATCA ACCGACTAGC TACTGGTGGT TTGTGAAAGG  AGTGGAAGGA TGGACTGGCA TTGTGATGGT TGTGCTAATG GCTATAGCCT TTACACTCGC GACGCCTTGG TTCCGACGTA ACAAGCTTAA CTTACCTAAC TTCCTCAAGA AGCTTACCGG  TTTCAACGCC TTTTGGTACA CCCACCATTT GTTCATCATT GTTTATGCTC TTCTCATTGT CCATGGTATC AAGCTCTACC TCACAAAGAT TTGGTATCAG AAAACGACAT GGATGTATCT  TGCTGTACCC ATCCTTCTAT ATGCATCGGA GAGGCTGCTC CGTGCTTTCA GATCAAGCAT CAAACCGGTT AAGATGATCA AGGTGGCTGT TTACCCCGGG AACGTGTTGT CTCTACACAT  GACGAAGCCA CAAGGATTCA AATACAAAAG TGGACAGTTC ATGTTGGTGA ACTGCCGAGC CGTATCTCCA TTCGAATGGC ATCCTTTCTC AATCACATCA GCTCCCGGAG ACGATTACCT  GAGCGTACAT ATCCGCACTC TCGGTGACTG GACACGTAAG CTCAGGACCG TTTTCTCCGA GGTTTGCAAA CCTCCTACCG CCGGTAAAAG CGGTCTTCTC CGAGCAGACG GAGGAGATGG  AAACCTCCCG TTCCCGAAGG TCCTTATCGA CGGTCCATAC GGTGCTCCCG CACAAGACTA CAAGAAATAC GACGTGGTAC TCCTCGTAGG TCTCGGCATT GGAGCCACGC CTATGATCAG  TATCCTTAAG GACATCATCA ACAACATGAA AGGTCCTGAC CGCGACAGCG ACATTGAGAA CAATAACAGT AACAACAATA GTAAAGGGTT TAAGACAAGG AAAGCTTATT TCTACTGGGT  GACTAGGGAA CAAGGATCAT TCGAGTGGTT CAAGGGAATA ATGGACGAGA TTTCGGAGTT AGACGAGGAA GGAATCATCG AGCTTCACAA TTATTGCACG AGTGTGTACG AGGAAGGTGA  TGCAAGAGTG GCTCTCATTG CCATGCTTCA GTCGTTGCAA CACGCTAAGA ACGGTGTGGA TGTTGTGTCG GGTACACGTG TCAAGTCCCA CTTCGCTAAA CCTAACTGGA GACAAGTCTA  CAAGAAGATC GCTGTTCAAC ATCCCGGCAA AAGAATAGGA GTCTTCTACT GTGGAATGCC AGGAATGATA AAGGAATTAA AAAATCTAGC TTTGGATTTT TCTCGAAAGA CAACTACCAA  GTTTGACTTC CACAAAGAGA ACTTCTAGAT TAATTATATA CGTTGTAGAA AAATAAAACA AGAAACAACT ATACAAATAA ATATTTATTT TAAATTCTTT TCATTTTTAT GTAAAATTAT  CTGAGTTATC TTTTTTTGTT CTTCTATATC CCTACCGTTT TGTTGGTTAC TTTTTCACTA CTTAGTTTAA TGCCAAATTA AGTATAAGAT AGTAGAAGTT TATATAGTTA CAGCTTTGGT 
GTTGTAAACA TGTAATCATG GAGTTATCTG TACTATTATT TTGTACTTAT ATTCGAATAT TAACAACTAA AGATAGTTTT G 

Retrieve as FASTA