Entry information : SmPrx06-1_110 (SmPrx06a_110)
Entry ID 3322
Creation 2009-12-01 (Christophe Dunand)
Last sequence changes 2009-12-01 (Christophe Dunand)
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx06-1_110 (SmPrx06a_110)
Name (synonym) SmPrx06-1_110 (SmPrx06a_110)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type Whole plant
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx06-1_110
start..stop
S start..stop
SmPrx06-2_11 642 0 1..339 1..339
SmPrx05-1_110 609 0 4..339 1..336
SmPrx05-2_11 589 0 25..339 22..336
SmPrx27-1_10 401 5e-141 13..338 5..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 420805..421017 213 N° 2 420545..420742 198 N° 3 420324..420486 163 N° 4 419823..420268 446
complement(join(419823..420268,420324..420486,420545..420742,420805..421017))


exon

Literature and cross-references SmPrx06-1_110 (SmPrx06a_110)
Literature Weng,J.-K., Tanurdzic,M. and Chapple,C. Functional analysis and comparative genomics of expressed sequence tags from the lycophyte Selaginella moellendorffii. BMC Genomics 6 (1), 85 (2005)
DNA ref. Phytozome 12:   scaffold_110 (421017..419823)
mRNA ref. JGI transcript:   269699
EST ref. GenBank:   DN839448 [5' end]
Protein sequence: SmPrx06-1_110 (SmPrx06a_110)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (316)
PWM (Da):   %s   36676.26 (34402.1)  
PI (pH):   %s   5.46 (5.46) Peptide Signal:   %s   cut: 24 range:24-339
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASMSPQQLLCLLLIAAACSASARPDSLHSYAQSCPRAEQIVAATVKSAADRDPTTPAGIIRLFFHDCFVQGCDASILLESTPTDGKDVEMFARPNINSVRGFEIIEAAKTQLEAVCPGVVSCADVLAFAARDATTYFGGMFYTVPTGRLDGRISSRTEADSLPGPRLPFSELREIFDGKKLSVHDLVLLSGGHTIGRAKCRFVEDRIYNFSDTGSPDPRLDATYREELRRICPQGANPGPTVALDRNSEFSFDNAYYRNLEANRGLLSSDAVLRTDPDAANLINSLAQNPPTFLSMFAQSMINMGNIEWKTRANGEIRKKCSAVNSRITTEVGDVASF

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns), 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAATGTCCCCGCAGCAGCTTCTCTGCCTACTCCTCATAGCAGCAGCTTGTTCTGCGTCTGCTCGTCCCGATTCTCTTCACAGCTATGCTCAATCTTGTCCGAGAGCTGAACAG
ATAGTCGCGGCCACTGTCAAGAGTGCGGCGGACCGGGATCCAACAACACCAGCCGGCATTATCCGCTTGTTCTTCCACGACTGCTTTGTCCAA
GTAAGCTCGTCGTCCTTAGCAGCTTTG
TATGTGAGTTGTGACGAATGTGTTTATTTGTCCAGGGGTGCGATGCTTCAATACTTTTGGAATCCACTCCTACTGATGGGAAAGATGTGGAGATGTTCGCGCGCCCGAACATCAACTCTG
TTCGTGGTTTCGAGATTATCGAGGCGGCAAAGACCCAGCTGGAGGCTGTGTGCCCGGGAGTTGTGAGCTGTGCGGATGTTCTCGCGTTTGCTGCCAGGGACGCGACAACTTAC
GTAAGCA
CAAGTCGGCTTTTGTTGATTTCTCTTTGACTTTGCCGGCAAATTTATGTAGTTTGGAGGGATGTTCTACACGGTGCCTACGGGTCGCCTTGACGGACGAATCTCTAGCAGAACAGAAGCC
GACAGCTTACCCGGCCCCAGGTTGCCGTTCAGTGAGCTGAGAGAGATCTTCGATGGCAAAAAATTGTCAGTTCATGACCTCGTGCTGCTCTCCG
GTAAGAAGTTTCTGTTCAAGCTAGAA
ATCTCCACCAACATTGCCGTAACTTACAGGCGGACACACCATTGGTCGCGCAAAGTGTAGATTCGTCGAGGATCGTATCTACAACTTTAGCGACACCGGAAGTCCCGATCCACGCCTGGA
CGCTACGTACCGTGAGGAGCTCCGGCGGATTTGCCCGCAGGGAGCAAACCCGGGCCCGACGGTGGCGCTGGACAGGAACTCGGAGTTTAGCTTCGACAACGCTTACTACAGGAACCTCGA
GGCCAACAGGGGGCTGCTTTCGTCGGACGCGGTGCTCCGGACCGACCCGGACGCTGCCAATCTCATCAACTCGCTCGCTCAGAACCCGCCAACGTTCCTCTCCATGTTCGCGCAGTCGAT
GATCAACATGGGAAACATCGAGTGGAAGACGAGAGCCAACGGGGAGATAAGGAAGAAGTGCTCGGCCGTGAACTCCAGGATCACCACCGAAGTGGGCGACGTTGCGTCCTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAATGTCCCCGCAGCAGCTTCTCTGCCTACTCCTCATAGCAGCAGCTTGTTCTGCGTCTGCTCGTCCCGATTCTCTTCACAGCTATGCTCAATCTTGTCCGAGAGCTGAACAG
ATAGTCGCGGCCACTGTCAAGAGTGCGGCGGACCGGGATCCAACAACACCAGCCGGCATTATCCGCTTGTTCTTCCACGACTGCTTTGTCCAA
GGGTGCGATGCTTCAATACTTTTGGAA
TCCACTCCTACTGATGGGAAAGATGTGGAGATGTTCGCGCGCCCGAACATCAACTCTGTTCGTGGTTTCGAGATTATCGAGGCGGCAAAGACCCAGCTGGAGGCTGTGTGCCCGGGAGTT
GTGAGCTGTGCGGATGTTCTCGCGTTTGCTGCCAGGGACGCGACAACTTAC
TTTGGAGGGATGTTCTACACGGTGCCTACGGGTCGCCTTGACGGACGAATCTCTAGCAGAACAGAAGCC
GACAGCTTACCCGGCCCCAGGTTGCCGTTCAGTGAGCTGAGAGAGATCTTCGATGGCAAAAAATTGTCAGTTCATGACCTCGTGCTGCTCTCCG
GCGGACACACCATTGGTCGCGCAAAG
TGTAGATTCGTCGAGGATCGTATCTACAACTTTAGCGACACCGGAAGTCCCGATCCACGCCTGGACGCTACGTACCGTGAGGAGCTCCGGCGGATTTGCCCGCAGGGAGCAAACCCGGGC
CCGACGGTGGCGCTGGACAGGAACTCGGAGTTTAGCTTCGACAACGCTTACTACAGGAACCTCGAGGCCAACAGGGGGCTGCTTTCGTCGGACGCGGTGCTCCGGACCGACCCGGACGCT
GCCAATCTCATCAACTCGCTCGCTCAGAACCCGCCAACGTTCCTCTCCATGTTCGCGCAGTCGATGATCAACATGGGAAACATCGAGTGGAAGACGAGAGCCAACGGGGAGATAAGGAAG
AAGTGCTCGGCCGTGAACTCCAGGATCACCACCGAAGTGGGCGACGTTGCGTCCTTCTAG

Retrieve as FASTA