Entry information : DrPOX01 (EPO-like / mpx)
Entry ID 3347
Creation 2006-07-18 (Christophe Dunand)
Last sequence changes 2011-02-03 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2011-07-21 (Nizar Fawal)
Peroxidase information: DrPOX01 (EPO-like / mpx)
Name (synonym) DrPOX01 (EPO-like / mpx)
Class Non mammalian vertebrate peroxidase    [Orthogroup: POX001]
Taxonomy Eukaryota Metazoa Chordata Actinopterygii Cyprinidae Danio
Organism Danio rerio (Zebrafish)    [TaxId: 7955 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DrPOX01
start..stop
S start..stop
SiniPOX 972 0 5..726 5..727
TrubPOX01 968 0 7..731 5..733
GacPOX 912 0 1..729 1..727
TrubPOX02 883 0 52..726 1..676
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 414..471 58 N° 2 1193..1286 94 N° 3 1382..1557 176 N° 4 1650..1782 133
N° 5 1864..1993 130 N° 6 2079..2285 207 N° 7 2375..2732 358 N° 8 3555..3715 161
N° 9 3807..4065 259 N° 10 4156..4326 171 N° 11 4419..4656 238 N° 12 5246..5442 197
N° 13 5678..5715 38 N° 14 6036..6089 54 N° 15 6223..6237 15  
join(414..471,1193..1286,1382..1557,1650..1782,1864..1993, 2079..2285,2375..273 2,3555..3715,3807..4065,4156..4326, 4419..4656,5246..5442,5678..5715 ,6036..6089,6223..6237)


exon

Literature and cross-references DrPOX01 (EPO-like / mpx)
Literature Bennett C.M., Kanki J.P., Rhodes J., Liu T.X., Paw B.H., Kieran M.W., Langenau D.M., Delahaye-Brown A., Zon L.I., Fleming M.D., Look A.T. Myelopoiesis in the zebrafish, Danio rerio. Blood 98:643-651(2001).
Protein ref. UniProtKB:   Q90XS6
DNA ref. GenBank:   NC_007121.4 (7974941..7982022)
Cluster/Prediction ref. UniGene:   Dr.9478
Protein sequence: DrPOX01 (EPO-like / mpx)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   762 (742)
PWM (Da):   %s   84967.19 (82941.2)  
PI (pH):   %s   7.18 (7.20) Peptide Signal:   %s   cut: 21 range:21-762
Sequence 803
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNLPTFLFVVGCCCALSVGAEEESPGRPFILDSIEEAKKIVDAAYKYSRDESLARVRKDVIKPSDKLRLLKQPARKTREAVRAADYMAQTLRLISEKAHHVHKRSINATNLLTQDELQTITRMTGCEAQTRPPSCRTTPLINKYRTASGVCNNRKNPLLGASNTPFARWLPAQYEDAVSQPKGWDPNKLYNGAALPMVRLVSNRILATADADIESDHDFTFMLTIFGQWVDHDLTFTPFSPSIRSFSNGIDCENSCERSEPCFPISAPPGDQRLRPNTCLPVFRSAPTCGSGHTAYMFGEVPNVREQINTLTAYLDAGQVYGSEDGLAKELRDLTNDGGLLRVNNRFKDNGRELLPFTSVNTNLCATRQKILNDSTLTEVPCFIAGDARVDENPALNSLHTLFVREHNRLARALHVLNPTWSSETLYQEARKIVGAFNQILVIKEYLPLIVGPDAYNRHLGPYPGYNENVDPTIANVFATAAFRFAHLTIQPFIFRLDENYKNHPQFPSVPLYEAFFSPWRVIFEGGIDPVLRGLIGRPAKLNTQDHMLVNALRERLFAFTSHIALDLASLNMQRGRDHAIPGYNAWRRFCGLSAPQNEQELAVVMNNTKLARKLIELYGTPENIDVWLGGVAEPFAPGGRVGSLFACLISRQFQKIRDGDRLWFESNGVFTTKQKTALASVSMARIICDNTGILKVPRDPFRFRSPASFVNCGNIPAFDLEPWKETGDGGINISDIGNEIEIPSQDLPDPGDLQENVVHRV

Retrieve as FASTA  
Remarks Complete sequence from DNA (chromo 10, 12 introns), 8 cDNA and 61 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAATCTTCCCACTTTTCTTTTTGTGGTGGGCTGCTGTTGTGCTCTTTCAATGGGGGGTAAGTTTATGTTTTATGCCAACAAAATTAAAACAGGTAATGCTTAACAATATAGAAGCAGAA
GTCTGGTGCTAAAAACTTTTGTGTGACGGGTAATTTTGGGTCTTTTTTTTAAATTATTAATTTTATTTAATAATTTAATTAAAATTATTTTGTTCATCAAGGTGGAAAAAATGTAATTGT
TAAATGTTCATTAAATGTTTATTTATTATTGTAGTTTACTATTAATTAAATAATAATAATAATAAGTATGATAATAACAAGAATAATTAATATTAGAATGATTTCTAAAGGGTCATGTGA
CAGAAGACTGGAGTAATGAACCTGAAAAATCCTCTCTAAAATCACTGGAATAAATTATTAAATTAAATTATAAACTACTTTTGAACAATTATTTAATGGTGCCATAACATTTCACAATTT
TAGTATTTAATAAATGTAAATGTAAAAAGTAATTTTAGTAATAAATGCAGCCTTGGTGAGCAGAATAAGCTTATTTTAAACATTTTAAAATCCCATTTTAAAAATTTTATGACCCCAAAC
TATTGACTGGCAGTGTACATCTGTGCATTGCTGCATGATTCAATGTGAAAACCAAGAAAAACAAGTTAAACAAAACAGATATTAATTATTAATGCCATGTGTAAGTGTGAACTTTTTCTC
TTACTAGACAAGACTTTGGAGTCATTAAAATGAGTAATTATTATCTTTGTCTTTTTAGCAGAAGAAGAGAGTCCTGGAAGACCTTTTATTCTTGATTCAATTGAGGAAGCAAAGAAAATA
GTAGACGCTGCTTACAAGTATTCTCGAGATGA
GTGAGTAAAGTTTGTAAGAATGTTGCTCAGTACTCCTGTGTCACCATTCCAGTCATTGATCTATCAGTTTTTTAAATATATCTCTCAA
CCTTTAGGAGTTTAGCAAGGGTGCGCAAAGATGTCATTAAGCCTTCTGACAAGCTACGTCTGTTGAAACAGCCAGCTCGAAAGACACGGGAGGCCGTAAGAGCTGCAGACTACATGGCAC
AAACGCTGAGACTGATCAGTGAGAAAGCCCATCATGTACACAAGAGGTCCATCAATGCCACAA
GTATGAAGACGAAATATTGTAAAACACTCAGGTCTTAGATCAGATCCATCACTGTGA
AGTGGCATTCTGAATAATTTATTTGTTTCCTTCAGACCTGCTCACTCAAGACGAGCTTCAAACCATTACACGTATGACAGGCTGTGAAGCTCAAACCCGGCCACCATCTTGTAGGACCAC
ACCCCTCATAAACAAGTATCGAACTGCCAGCGGTGTCTGCAACAATCG
GTCAGTCTTCTGGATGAAATTCATATTGAGAGTAGTTTATACTGACAGTTGTTTATTGACAGCGTAATTTAT
TATTTCCAGGAAGAACCCACTTCTTGGTGCATCCAACACTCCATTTGCCCGCTGGTTGCCTGCTCAATATGAGGACGCCGTTTCTCAGCCAAAAGGATGGGATCCCAACAAGTTGTACAA
TGGTGCAGCGCTGCCCATG
GTATGATTATAATGAATAGCTTACTGAAGTCTACTTGACAATCAAGTAGGTCACCTATTTATTCAGTCTTCCTCATTGATTTCAGGTTAGACTGGTTTCCA
ATCGCATTCTAGCCACTGCAGATGCTGACATAGAGAGTGACCATGACTTTACCTTCATGCTCACCATCTTTGGGCAATGGGTTGACCACGATCTGACTTTTACACCTTTCTCACCAAGTA
TTAGGTCCTTTAGTAATGGCATTGACTGTGAAAACAGTTGTGAGCGCTCTGAACCCTGCTTCCCAATTTCG
GTCAGTCAAAGACTGCTCATCTTATTGCATTGTAAAACCCTTGTAGCTG
TAAAACAGTTTTTCATGCTATGTTTAATCTCTTAACATAGGCCCCTCCAGGAGATCAGCGTCTGCGCCCTAACACCTGTCTCCCTGTCTTCCGGTCAGCACCGACTTGTGGTTCTGGGCA
CACTGCCTACATGTTTGGTGAAGTCCCAAATGTTCGGGAACAGATCAATACTCTAACAGCTTACCTAGATGCTGGACAAGTTTACGGTTCAGAGGATGGACTAGCAAAGGAACTGCGGGA
CCTTACTAATGATGGTGGCCTTTTACGTGTTAATAATCGTTTTAAAGACAATGGACGAGAGCTCCTGCCCTTTACTAGTGTTAACACCAACTTGTGCGCCACTCGTCAGAAAATCCTCAA
CGACAGCACTCTGACAGAGGTTCCTTGCTTCATTGCGG
GTATGTTAAAGTTTTGTTATCCTTTAAATCTTATTTCTTCATATGCAGTTATCAGGCATATTACTGGTCACCATTGGTAAAT
CTAGTTAAAGTGAAGTTTATTCATAAACTAATATCGAGAGGAGCACGTGATTATGATTGAACACGGCTGGTTCTAAATTAGCATGCATGATCCACCAATCAGGCCATTCCTAACCCACTA
TAAAGAGCCAGGGTTTTTTCACTACAGTCATCTTCGATTTGAAGAATCCCCCCTTCCACCCCTACCTTTTCACCTTTCCCTCCATAGGGCAGCACGGTGGCCCAGAGACTAGCACTGGCG
CCTCACAGCAAGAACGTCACCGGTTCTAGTCCTTCAACAGGCCGGTGGTCGTTTCTGTGTGTAGTTTGCATGTTCTACCCGTGCTTGCGTGGGTTTTCCCCGGGTCCTCCGGTTTCCTCC
CACATTCCAAAAACATGCACAACAAGTAAATTGATAAATCTAAATTTGCAATTCAGGTAATCTTATATTATCTTATCTTATATTATATTATTATATATAATCTTATTTCAGCATATCTTG
TAATAGCATTCAATTTTTAGTTATCAGCTCTTATCAAGGGGGAGTTGTCGAGATCTACCTGAGCTCGAGGCTCCCCTCTCTTCCTCCAAACGGGAGGGAGCCCAGGGCTCAAGAACCTTC
GAGCTCAGGGCTCTCTCCTGGGACAGCATGCCAAACTTGCTTATAATCAATCATCTGCTAAGTGTGAACTCTTGAAATGTAAGCTATATACATACACAATTTAGGTTTGACAAATGCTAA
TGAACTCTCAATGTGGGTAGGTGATGCTCGTGTCAATGAGAATCCTGCTCTGAACTCCTTACACACACTTTTTGTAAGGGAGCACAATAGATTGGCTCGCGCCCTTCATGTGCTCAACCC
TACCTGGAGTAGTGAAACTCTTTATCAAGAAGCAAGAAAAATTGTCGGTGCATTCAACCAG
GTAAAGGCACTCAATGAAAAGCACATCAACATAAGGAGTTATGTGTGAAATGCATCATA
TGTGGATGATCAATTTCTCCTTTCTCTTTTAGATCTTGGTGATCAAGGAATACTTGCCACTAATTGTAGGCCCTGATGCTTACAATAGACACCTTGGACCATATCCAGGTTACAATGAGA
ATGTAGACCCTACCATTGCGAACGTCTTTGCCACTGCTGCTTTCCGTTTTGCCCACTTGACTATCCAGCCCTTCATTTTTCGTCTTGATGAAAACTACAAGAACCATCCTCAGTTTCCCA
GTGTCCCCCTCTATGAGGCTTTCTTCTCTCCATGGAGGGTGATCTTTGAAG
GTGAGTTTGTGAGACTTGTTGCAGCATACCCACTGGGTACTAAATTTGCCACAAGTGTCTCCATTCAAT
CTAATGTTTTTTCTTGGCTAGGGGGCATTGATCCTGTGCTCCGTGGACTGATTGGTCGTCCGGCAAAACTGAACACCCAGGACCACATGTTGGTGAATGCTCTCAGAGAGAGGCTGTTTG
CCTTCACATCCCACATAGCTTTGGATCTGGCTTCCCTCAACATGCAAAGAGGGCGTGACCATGCTATACCAG
GCAAGTTTATCTCTGCTTCATGTTGCATCATCATTTTAAGTGTATTTT
GGATTTAAGTCTGAATGGATATCCATTCGTTGTTCCTCTTATAGGTTATAATGCATGGCGTCGGTTCTGTGGATTGTCTGCTCCTCAGAATGAGCAAGAATTGGCTGTGGTGATGAACAA
CACTGAACTAGCCCGCAAGTTAATTGAGCTTTATGGCACCCCTGAGAACATTGATGTTTGGTTAGGAGGTGTTGCTGAGCCTTTTGCTCCTGGTGGTCGTGTCGGTTCTCTTTTTGCCTG
CCTGATTTCAAGACAGTTCCAGAAAATCCGAGATGGCGATAG
GTAACAATCTTTCAGTGTTTAGTAGGGGTGTTTAATTTTTCTCCTAGAGGTCCATTATCTTCTTTCCAACCTAATCTA
TTTATCAAAGTCTTTAAGAAAGTTCATCAGATGTGCTGGGTCATTCATAATTTTTTTTTTTTCGGCTTACTCTCTTTATTAATCAGAGGTCGCCACAGTGCCAACTTATTTAGCATATGT
TTTACACAGCGAATGCCCTTCCAGCTGCAACCCATCACTGGGAAACCCCCATACATTCTCATTCACACACACATACACTACGGCCAATTTAGCTTATAGCACATGTCTTTGGACTTGTGG
GAGAAACCGGGAAAGCGGTGGAAACTCACCTGAACAAAGGGAAAACATGCAAACTCCACAGAGAAATGCCAACTGACCCAGCCGAGGCTCGAACCAGTGCTGCGAGGCTTCTTGCTACTC
ACTGCTCCGCCGCACCGCCTGTGCTGGGTCATGTTAAGAGTTAAACTCTGCAAGACACTGCAGTAGGAAGTCAGGACACCCTAATGAAGTTTGTGAAAAATATTTAGTTGTCTTGGAGAG
GTGTTAATGCCAAGTCTTGCTTTGTGTTTAGGTTGTGGTTTGAGAGCAATGGAGTGTTCACCACCAAACAGAAAACAGCTCTGGCCTCTGTGTCGCTGGCCCGCATAATCTGCGACAACA
CCGGAATCCTTAAAGTTCCCAGAGATCCTTTTCGCTTCCGGAGTCCTGCCAATTTTGTTAACTGTGGGAATATCCCAGCTTTTGATCTCGAGCCTTGGAAAGAGACTG
GTGAGACATCAT
ACAGTACCTTTTAACTGCTGCATGCTTATACATAAATCTTCTGGGGATGCTTAAACGTAAACCTTCTGCTTGTACATAAATCTCAGCCTAAACTTCCTGATTGCTTTATATGTGCTTGTA
GAGTACCTAATTTTGGTGGTAAAGGCACATATAAAGTATTGCATATATCATGGTACGGTGACCATGGTTTAGTTCACCTGTGATTTGGTGTTTGACCTTCCAGGTGATGGTGGCATCAAC
ATTTCAGACATTGGAAATGAG
GTTAGATGAGTGTTTATTCTCTCCCAATCCAAAAGAGAAAGTTTTTTTTTATTATTTCACTACAAATCTGGACAAACTAAGAAGCTTCTTTGCTGTACA
ATGGTTTGGTGCAGTGATATTTATTAATGAATCTGGATGTAACAACTGTCAAGCTGTATTTTATGACTGCACTAAACTATTGCAAGCTGTTAACCTTTTTCCTAGCCTTTCATTGGTTTA
AGGGGATTTGCTTCAAATTGAAAACAAATGCTTTGTTGTTGTTTAATGACAATTCTTAGGCTTGTAATACTAACACATTACATCTTTTTATTGCTACACAGATAGAGATTCCATCCCAGG
ACCTCCCGGACCCAGGGGACCTCCAGGAGAACGTG
GTAAGGCATTGAAATGTCAAAAAAGTCCTCTAAATATTTTATCAACACACACACAAAAAAACCAAAACTAATGAATAGATAATAA
ATACCACAATATTCATTATAATTTTCTCCAATCTCTATTTTGTTTCAGGTCCACAGGGTGTAG

Retrieve as FASTA