Entry information : MtPrx09 (Medtr4g125940.1[4.0])
Entry ID 336
Creation 2006-01-18 (Christophe Dunand)
Last sequence changes 2014-07-15 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-04-07 (Catherine Mathe)
Peroxidase information: MtPrx09 (Medtr4g125940.1[4.0])
Name (synonym) MtPrx09 (Medtr4g125940.1[4.0])
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Roots
Roots nodules
Inducers Glomus intraradices infection
Phosphate starvation
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx09
start..stop
S start..stop
LjPrx26 563 0 10..330 13..333
GmPrx235 552 0 1..330 1..330
GmPrx76 550 0 1..330 1..330
GmPrx288 540 0 9..330 10..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 52301027..52301245 219 N° 2 52301504..52301689 186 N° 3 52301880..52302045 166 N° 4 52302426..52302847 422
join(52301027..52301245,52301504..52301689,52301880..52302045,52302426..52302847 )


exon

Literature and cross-references MtPrx09 (Medtr4g125940.1[4.0])
Literature Fedorova,M. et al., unpublished, Harrison,M.J. et al., unpublished.
DNA ref. Phytozome 12:   chr4 (52301027..52302847)
Cluster/Prediction ref. Phytozome Gene 12:   31113266 UniGene:   Mtr.14019
Omic ref. Gene atlas:   Mtr.28457.1.S1_s_at   Mtr.37598.1.S1_at Legoo:   Mtr.28457.1.S1_s_at   Mtr.37598.1.S1_at
Protein sequence: MtPrx09 (Medtr4g125940.1[4.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (305)
PWM (Da):   %s   35807.83 (32593.3) Transmb domain:   %s   i7-24o
PI (pH):   %s   6.97 (5.70) Peptide Signal:   %s   cut: 26 range:26-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKNSFRWSCYYFVLINMFMLHFTVRSQLTTDFYKSSCPNLTKIVRKEVVKALKNEMRMGASLLRLHFHDCFVNGCDGSILLDGGDDFEKSAFPNINSVRGFDVVDTIKTAVESACSGVVSCADILAIAARDSVLLSGGPSWSVMLGRRDGTISNGSLANVVLPSPFDPLDTIVSKFTNVGLNLTDVVSLSGAHTIGRARCALFSNRLFNFSGTGSPDSTLETGMLTDLQNLCPQTGDGNTTAVLDRNSTDLFDNHYYKNLLNGKGLLSSDQILISTDEANSTSKPLVQSYNDNATLFFGDFVKSMIKMGNINPKTGSDGEIRKSCRVINS

Retrieve as FASTA  
Remarks Complete sequence from 15 ESTs and genomic (chromo 4, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAACTCATTTAGATGGAGCTGTTATTACTTTGTGCTAATCAATATGTTCATGTTGCATTTTACAGTAAGGTCCCAACTGACAACAGACTTCTATAAGTCATCTTGTCCTAACCTT
ACAAAGATAGTAAGGAAAGAGGTTGTAAAAGCTCTAAAGAATGAGATGAGAATGGGTGCTTCTTTGCTTCGTCTTCACTTTCATGATTGCTTTGTCAAT
GTAAGCTTAATTACTTGAGAT
ACATGTACATGCATGCATAGTTTTTTATTTATTATATGCATACATAGTATTAAGAAAAATGCTATTTCTAGCGAAGGAACTACCTAGCGAATTTTTTCCGGAAACATTATTTCTCACAAA
CATGACAAAGTCCAAAACAACGTACAAATTCGTGATAACAATATTTTGTGACATTTAGCATTTTACAACATTTTTTATAACAAGGATTCACTTTCAAATTATTATTTTGATTATCAGGGT
TGTGATGGATCAATATTATTAGATGGTGGCGATGATTTTGAAAAGTCTGCATTTCCTAATATCAACTCTGTTAGAGGATTTGATGTTGTTGATACAATCAAAACGGCAGTGGAAAGTGCG
TGTAGCGGAGTTGTCTCATGTGCTGATATACTTGCCATAGCTGCCAGAGATTCTGTTCTTCTT
GTAATTATATATTCCAATCCCATAACGTTCTTAATTTATTCATATACATATTTTGTT
TATAGTCAAGGAGCATGCATAAAACTAAATATGAAATCTAATTTCAATTAATTACTTATATAGACTATAATAATAAATTTCTTTCATACTTTTTAGAAAAACTATATCATGACCATTATA
TAATGTTTGGCAGAGTGGTGGTCCTTCATGGAGTGTTATGTTAGGACGAAGAGACGGAACAATCTCAAATGGATCTCTAGCAAATGTGGTGCTTCCTTCTCCATTTGACCCACTAGATAC
TATTGTGTCAAAGTTTACCAATGTAGGGCTCAATCTCACAGATGTTGTTTCTTTATCAG
GTAAATAGTGAATTTCACTGTGGAGATCCATAGAAATTATATAGGCCTAAAATAGGGGATG
ATCCTATTTTTAGAATTGAGTTAGACTCAAATCTAAAGCCCTTAAAGATTGTTAGCTAGTTTGGAAGAGATGGCAACTCTTAGAATTTAAGTTTGATTTTTAATTTTTTTTATATTAACC
TTCTGATTTTAGTAAAAGCGAACCATAGTAACTAGGTATTCAACGATCGGGTACATAAAGTACGGTCAATAATTGTAAAAATCAAATGTTGAACTTGTTGCTCCTAAACGATTTGACCTT
AAGTAACACTTGAATCGATCTACTTGCTTAATTTTACCTTTAATTAAATTGCTCATATGTATATGCTTAATTTGTGAAGGTGCTCATACGATTGGGAGAGCAAGATGTGCACTGTTTAGC
AATAGATTGTTCAATTTTTCTGGAACAGGTTCACCAGACAGTACACTGGAAACCGGTATGCTAACCGACCTACAAAATTTGTGTCCTCAAACTGGGGATGGAAACACAACTGCAGTTCTT
GATAGGAACTCAACTGATCTCTTTGATAATCATTACTATAAGAACTTGCTTAACGGAAAGGGTCTTCTTAGTTCTGATCAGATTTTGATTTCTACTGATGAGGCAAATTCAACTTCTAAA
CCATTAGTTCAAAGCTACAACGATAATGCTACGCTTTTCTTTGGAGACTTTGTCAAATCTATGATCAAGATGGGGAATATAAATCCAAAAACTGGGTCTGATGGAGAGATTAGGAAGAGC
TGTAGAGTGATAAATTCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAACTCATTTAGATGGAGCTGTTATTACTTTGTGCTAATCAATATGTTCATGTTGCATTTTACAGTAAGGTCCCAACTGACAACAGACTTCTATAAGTCATCTTGTCCTAACCTT
ACAAAGATAGTAAGGAAAGAGGTTGTAAAAGCTCTAAAGAATGAGATGAGAATGGGTGCTTCTTTGCTTCGTCTTCACTTTCATGATTGCTTTGTCAAT
GGTTGTGATGGATCAATATTA
TTAGATGGTGGCGATGATTTTGAAAAGTCTGCATTTCCTAATATCAACTCTGTTAGAGGATTTGATGTTGTTGATACAATCAAAACGGCAGTGGAAAGTGCGTGTAGCGGAGTTGTCTCA
TGTGCTGATATACTTGCCATAGCTGCCAGAGATTCTGTTCTTCTT
AGTGGTGGTCCTTCATGGAGTGTTATGTTAGGACGAAGAGACGGAACAATCTCAAATGGATCTCTAGCAAATGTG
GTGCTTCCTTCTCCATTTGACCCACTAGATACTATTGTGTCAAAGTTTACCAATGTAGGGCTCAATCTCACAGATGTTGTTTCTTTATCAG
GTGCTCATACGATTGGGAGAGCAAGATGT
GCACTGTTTAGCAATAGATTGTTCAATTTTTCTGGAACAGGTTCACCAGACAGTACACTGGAAACCGGTATGCTAACCGACCTACAAAATTTGTGTCCTCAAACTGGGGATGGAAACACA
ACTGCAGTTCTTGATAGGAACTCAACTGATCTCTTTGATAATCATTACTATAAGAACTTGCTTAACGGAAAGGGTCTTCTTAGTTCTGATCAGATTTTGATTTCTACTGATGAGGCAAAT
TCAACTTCTAAACCATTAGTTCAAAGCTACAACGATAATGCTACGCTTTTCTTTGGAGACTTTGTCAAATCTATGATCAAGATGGGGAATATAAATCCAAAAACTGGGTCTGATGGAGAG
ATTAGGAAGAGCTGTAGAGTGATAAATTCGTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATAGAGGAAA ACATGAAAAC TAGATACAAT ATACAAACAA AAATGTCCTT ATACTATAAT AATACATATC AACTGAGACT AGTTTTTTCT TGGAGAAAGC AAACCAGATG AAGTTGAAGC  CCTTGAAATT ACTGAGACAA TGGAATGAAA AGCACTTGCT GCTATCTTTG ATTTTATTTG TCCTCTTTTT GGAAGAGACT TTTTGCCTCT AAACCTGTTC CTGTTGTTGA CAACTTCAGC  AGATGCAACA CGACCCATTC TAGTGTTCAT TATTATCTTT TAACAACAGA AATAAACTGA TATATGCTGC ATATCGCTGC TTTTGTCTTA GGCTACTAAT TAAGTAATTA ACGATGAAGA  ACTCATTTAG ATGGAGCTGT TATTACTTTG TGCTAATCAA TATGTTCATG TTGCATTTTA CAGTAAGGTC CCAACTGACA ACAGACTTCT ATAAGTCATC TTGTCCTAAC CTTACAAAGA  TAGTAAGGAA AGAGGTTGTA AAAGCTCTAA AGAATGAGAT GAGAATGGGT GCTTCTTTGC TTCGTCTTCA CTTTCATGAT TGCTTTGTCA ATGGTTGTGA TGGATCAATA TTATTAGATG  GTGGCGATGA TTTTGAAAAG TCTGCATTTC CTAATATCAA CTCTGTTAGA GGATTTGATG TTGTTGATAC AATCAAAACG GCAGTGGAAA GTGCGTGTAG CGGAGTTGTC TCATGTGCTG  ATATACTTGC CATAGCTGCC AGAGATTCTG TTCTTCTTAG TGGTGGTCCT TCATGGAGTG TTATGTTAGG ACGAAGAGAC GGAACAATCT CAAATGGATC TCTAGCAAAT GTGGTGCTTC  CTTCTCCATT TGACCCACTA GATACTATTG TGTCAAAGTT TACCAATGTA GGGCTCAATC TCACAGATGT TGTTTCTTTA TCAGGTGCTC ATACGATTGG GAGAGCAAGA TGTGCACTGT  TTAGCAATAG ATTGTTCAAT TTTTCTGGAA CAGGTTCACC AGACAGTACA CTGGAAACCG GTATGCTAAC CGACCTACAA AATTTGTGTC CTCAAACTGG GGATGGAAAC ACAACTGCAG  TTCTTGATAG GAACTCAACT GATCTCTTTG ATAATCATTA CTATAAGAAC TTGCTTAACG GAAAGGGTCT TCTTAGTTCT GATCAGATTT TGATTTCTAC TGATGAGGCA AATTCAACTT  CTAAACCATT AGTTCAAAGC TACAACGATA ATGCTACGCT TTTCTTTGGA GACTTTGTCA AATCTATGAT CAAGATGGGG AATATAAATC CAAAAACTGG GTCTGATGGA GAGATTAGGA  AGAGCTGTAG AGTGATAAAT TCGTAGAAAT ATGTTTTAGG GCTTTGCAAA ATATTAAATA AGTGGAAGAT TAGGAGTGTG TCTTCCTTGT GATAGTGCAG TTATGTTGTT GTTGCTAACT 
TGTAATGTTG TTTGTAAGGG TGTGCTTCTC GAACAAAATA TAATCATACA AAAATGAATA AAATTCTAAA TATAGGATTG TTGTTTCTAG CTTATGTTGG ATT 

Retrieve as FASTA