Entry information : MtPrx13 (Medtr1g101830.1 [4.0] / Medtr1g101830.1 [3.5] / Medtr1g129740.1 [3.0])
Entry ID 340
Creation 2006-01-17 (Christophe Dunand)
Last sequence changes 2010-09-16 (Haythem Mhadhbi)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx13 (Medtr1g101830.1 [4.0] / Medtr1g101830.1 [3.5] / Medtr1g129740.1 [3.0])
Name (synonym) MtPrx13 (Medtr1g101830.1 [4.0] / Medtr1g101830.1 [3.5] / Medtr1g129740.1 [3.0])
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Roots
Seedlings
Stems
Inducers Glomus versiforme infection
Nodulation
Pathogen interaction
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx13
start..stop
S start..stop
GmPrx77 572 0 1..322 1..322
GmPrx73 531 0 1..322 1..325
GmPrx185 531 0 1..322 1..325
MePrx90 505 0 13..322 14..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45972252..45972467 216 N° 2 45972584..45972772 189 N° 3 45973233..45973796 564  
join(45972252..45972467,45972584..45972772,45973233..45973796)


exon

Literature and cross-references MtPrx13 (Medtr1g101830.1 [4.0] / Medtr1g101830.1 [3.5] / Medtr1g129740.1 [3.0])
Literature VandenBosch,K. et al., unpublished
DNA ref. Phytozome 12:   chr1 (45972252..45973796)
Cluster/Prediction ref. Phytozome Gene 12:   31099924 UniGene:   Mtr.11435
Omic ref. Gene atlas:   Mtr.37908.1.S1_at Legoo:   Mtr.37908.1.S1_at
Protein sequence: MtPrx13 (Medtr1g101830.1 [4.0] / Medtr1g101830.1 [3.5] / Medtr1g129740.1 [3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (297)
PWM (Da):   %s   35262.95 (32517.4)  
PI (pH):   %s   8.01 (7.76) Peptide Signal:   %s   cut: 26 range:26-322
Sequence 363
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPLPAQNTFPILFLLFTIFALSKAELHAHYYDQTCPQLDKIISETVLTASIHDPKVPARILRMFFHDCFIRGCDASVLLDSTATNQAEKDGPPNISVRSFYVIDEAKAKLELACPGVVSCADILALLARDVVAMSGGPYWKVLKGRKDGRVSKASDTANLPAPTLNVGQLIQSFAKRGLGVKDMVTLSGGHTLGFSHCSSFEARLHNFSSVHDTDPRLNTEFALDLKNKCPKPNNNQNAGQFLDSTASVFDNDYYKQLLAGKGVFSSDQSLVGDYRTRWIVEAFARDQSLFFKEFAASMLKLGNLRGSDNGEVRLNCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, introns 1 and 2) and 7 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTCCTCTGCCAGCACAAAACACCTTTCCAATCCTTTTCCTCCTCTTTACAATATTTGCATTATCCAAAGCTGAACTTCATGCCCATTACTATGACCAAACATGTCCACAATTGGACA
AAATCATTTCAGAGACGGTTCTAACTGCTTCTATCCATGATCCAAAAGTCCCAGCCCGTATTTTGAGGATGTTCTTCCATGACTGTTTCATAAGG
GTAAGTATGATCGCTCAATCTCTCA
TTTAAAACACACACTCACACACATATATGCTATGTATAGTTTTTTTTACCAATGGGTTTGTAATCTTCTAATGATTAATGTTCAATGATAGGGATGTGATGCATCAGTGTTGCTGGACTC
AACTGCCACTAACCAAGCAGAGAAAGACGGCCCTCCTAATATCTCAGTTCGATCATTCTATGTGATTGATGAAGCTAAAGCAAAGCTTGAATTGGCTTGCCCAGGCGTTGTTTCTTGTGC
TGATATACTTGCTCTTTTAGCAAGAGATGTGGTTGCCATG
GTAATATCTATCTAAAACTAGTTTAGACCTGCTACAATCTTGATACTTCTAGGAAGCCATTTTATCCAATAAATGTATCC
TATATGCCTATGTAGAGTAGATATGTATGGTGATCTCGTAAAACATTTCATAGAAGAATTCAAGTCACTTAATATAGATTTAGCTAATAATACTTAGAAATTCAAAACGACGCATTTATA
ATTTCTATATGCAATATGAACACTCGCTACTAAGAAATACATTCAAAACGACATATTTATAATTTCTATATGCAATATGAACACTCGCTACTAAGAAATACATTCAAAACGACATATTTA
TAATTTCTATATGCAATATGAACACTCACTACTAAGAAATGCGAAACTTGAGTACCAAAGAAATTTTATCTAAGCTATTTAGTATACTGGGTATTGATATTTATAAATTATTTATTAACA
CTCCCTATTTGTTCTGACAGTCTGGAGGTCCATATTGGAAAGTACTAAAAGGACGGAAAGATGGAAGGGTATCAAAGGCATCTGATACCGCCAACTTACCGGCCCCAACCTTGAATGTAG
GCCAACTCATTCAGAGCTTTGCTAAGAGAGGGTTGGGAGTTAAAGATATGGTGACTTTATCTGGAGGACACACTCTGGGTTTCTCACATTGTTCTTCCTTTGAGGCTCGTCTACATAATT
TCAGTTCTGTTCATGACACTGACCCACGATTGAACACTGAATTTGCACTAGACCTAAAAAATAAGTGTCCAAAACCAAACAACAATCAAAACGCAGGACAGTTCCTGGACTCAACAGCAT
CAGTGTTTGATAATGACTATTACAAACAACTGCTGGCTGGAAAAGGTGTGTTTTCTTCCGACCAGTCACTTGTTGGTGATTACAGAACTAGATGGATTGTTGAAGCATTTGCAAGAGACC
AGAGTTTGTTTTTCAAAGAGTTTGCAGCTTCAATGTTGAAACTCGGAAATCTAAGAGGCTCCGATAATGGAGAAGTGAGACTTAATTGCAGGGTTGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTCCTCTGCCAGCACAAAACACCTTTCCAATCCTTTTCCTCCTCTTTACAATATTTGCATTATCCAAAGCTGAACTTCATGCCCATTACTATGACCAAACATGTCCACAATTGGACA
AAATCATTTCAGAGACGGTTCTAACTGCTTCTATCCATGATCCAAAAGTCCCAGCCCGTATTTTGAGGATGTTCTTCCATGACTGTTTCATAAGG
GGATGTGATGCATCAGTGTTGCTGG
ACTCAACTGCCACTAACCAAGCAGAGAAAGACGGCCCTCCTAATATCTCAGTTCGATCATTCTATGTGATTGATGAAGCTAAAGCAAAGCTTGAATTGGCTTGCCCAGGCGTTGTTTCTT
GTGCTGATATACTTGCTCTTTTAGCAAGAGATGTGGTTGCCATG
TCTGGAGGTCCATATTGGAAAGTACTAAAAGGACGGAAAGATGGAAGGGTATCAAAGGCATCTGATACCGCCAACT
TACCGGCCCCAACCTTGAATGTAGGCCAACTCATTCAGAGCTTTGCTAAGAGAGGGTTGGGAGTTAAAGATATGGTGACTTTATCTGGAGGACACACTCTGGGTTTCTCACATTGTTCTT
CCTTTGAGGCTCGTCTACATAATTTCAGTTCTGTTCATGACACTGACCCACGATTGAACACTGAATTTGCACTAGACCTAAAAAATAAGTGTCCAAAACCAAACAACAATCAAAACGCAG
GACAGTTCCTGGACTCAACAGCATCAGTGTTTGATAATGACTATTACAAACAACTGCTGGCTGGAAAAGGTGTGTTTTCTTCCGACCAGTCACTTGTTGGTGATTACAGAACTAGATGGA
TTGTTGAAGCATTTGCAAGAGACCAGAGTTTGTTTTTCAAAGAGTTTGCAGCTTCAATGTTGAAACTCGGAAATCTAAGAGGCTCCGATAATGGAGAAGTGAGACTTAATTGCAGGGTTG
TGAATTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CGGCCGGGGA TCCAATCCTC ATTTTACAGT TCTCAAGCTA TTACCTGGTT TATCAAATGG CTCCTCTGCC AGCACAAAAC ACCTTTCCAA TCCTTTTCCT CCTCTTTACA ATATTTGCAT  TATCCAAAGC TGAACTTCAT GCCCATTACT ATGACCAAAC ATGTCCACAA TTGGACAAAA TCATTTCAGA GACGGTTCTA ACTGCTTCTA TCCATGATCC AAAAGTCCCA GCCCGTATTT  TGAGGATGTT CTTCCATGAC TGTTTCATAA GGGGATGTGA TGCATCAGTG TTGCTGGACT CAACTGCCAC TAACCAAGCA GAGAAAGACG GCCCTCCTAA TATCTCAGTT CGATCATTCT  ATGTGATTGA TGAAGCTAAA GCAAAGCTTG AATTGGCTTG CCCAGGCGTT GTTTCTTGTG CTGATATACT TGCTCTTTTA GCAAGAGATG TGGTTGCCAT GTCTGGAGGT CCATATTGGA  AAGTACTAAA AGGACGGAAA GATGGAAGGG TATCAAAGGC ATCTGATACC GCCAACTTAC CGGCCCCAAC CTTGAATGTA GGCCAACTCA TTCAGAGCTT TGCTAAGAGA GGGTTGGGAG  TTAAAGATAT GGTGACTTTA TCTGGAGGAC ACACTCTGGG TTTCTCACAT TGTTCTTCCT TTGAGGCTCG TCTACATAAT TTCAGTTCTG TTCATGACAC TGACCCACGA TTGAACACTG  AATTTGCACT AGACCTAAAA AATAAGTGTC CAAAACCAAA CAACAATCAA AACGCAGGAC AGTTCCTGGA CTCAACAGCA TCAGTGTTTG ATAATGACTA TTACAAACAA CTGCTGGCTG  GAAAAGGTGT GTTTTCTTCC GACCAGTCAC TTGTTGGTGA TTACAGAACT AGATGGATTG TTGAAGCATT TGCAAGAGAC CAGAGTTTGT TTTTCAAAGA GTTTGCAGCT TCAATGTTGA  AACTCGGAAA TCTAAGAGGC TCCGATAATG GAGAAGTGAG ACTTAATTGC AGGGTTGTGA ATTGAGAAAC ATTAGAGACA AATTTGCCGT GAGTGTTTTT TGTCTTTGCA CCACTACAAT 
TATATACGAT ATTATCATAA TGATCTTGTT ACCACTCCAT GTTGAAATAA AATGTAATTA TGCCTTGTAT ACCTCA 

Retrieve as FASTA