Entry information : MtPrx15 (Medtr2g029850.1 [4.0] / Medtr2g029850.1[3.5])
Entry ID 342
Creation 2005-09-13 (Christophe Dunand)
Last sequence changes 2010-09-16 (Haythem Mhadhbi)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-25 (Catherine Mathe)
Peroxidase information: MtPrx15 (Medtr2g029850.1 [4.0] / Medtr2g029850.1[3.5])
Name (synonym) MtPrx15 (Medtr2g029850.1 [4.0] / Medtr2g029850.1[3.5])
Class Class III peroxidase    [Orthogroup: Prx043]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx15
start..stop
S start..stop
MsPrx15 689 0 3..352 4..353
GmPrx260 561 0 19..351 15..348
GmPrx69 556 0 19..351 14..346
LjPrx09 556 0 6..351 4..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11170841..11171062 222 N° 2 11171174..11171365 192 N° 3 11172358..11172523 166 N° 4 11172672..11173150 479
join(11170841..11171062,11171174..11171365,11172358..11172523,11172672..11173150 )


exon

Literature and cross-references MtPrx15 (Medtr2g029850.1 [4.0] / Medtr2g029850.1[3.5])
Literature Torrez-Jerez,I. et al., unpublished.
DNA ref. Phytozome 12:   chr2 (11170841..11173150)
Cluster/Prediction ref. Phytozome Gene 12:   31065145
Omic ref. Gene atlas:   Mtr.40130.1.S1_at Legoo:   Mtr.40130.1.S1_at
Protein sequence: MtPrx15 (Medtr2g029850.1 [4.0] / Medtr2g029850.1[3.5])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   352 (325)
PWM (Da):   %s   37769.93 (35062.6)  
PI (pH):   %s   6.11 (6.12) Peptide Signal:   %s   cut: 28 range:28-352
Sequence 393
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNSFNLSLAALCCVVVVLGGLPFSSNAQLDNSFYRDTCPNVHSIVREVLRNVSKTDPRILASLIRLHFHDCFVQGCDASILLNTTSTITSEQTAFGNNNSIRGLDVVNQIKTAVENACPNTVSCADILALAAEISSVLANGPDWKVPLGRRDSLTANLTLANINLPSPAFNLTQLKSNFDNQGLDATDLVALSGAHTIGRGQCRFFVDRLYNFSNTGNPDPTLNTTYLQTLRTICPNGGPGSTLTDLDPATPDTFDSAYYSNLRIQKGLFQSDQVLSSTSGADTIAIVNSFNNNQTLFFEAFKASMIKMSRIKVLTGSQGEIRKQCNFVNGNSGLATKVTRESSEDGIVSSY

Retrieve as FASTA  
Remarks Complete sequence from 160 ESTs and genomic (chromo 2, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAACTCTTTCAATCTCTCTTTGGCAGCTTTGTGCTGTGTAGTAGTTGTGCTTGGAGGGTTACCCTTCTCATCAAATGCACAACTTGATAATTCCTTCTATAGGGACACTTGTCCTAATG
TTCATTCCATTGTTCGTGAAGTACTAAGAAATGTTTCTAAGACAGATCCTCGTATACTTGCTAGTTTGATAAGGCTTCACTTCCATGATTGCTTTGTTCAA
GTAAGTATTATTCATCATT
TTTAAAACTCGGTATCTGATCAAGGACCGACTGATCCGTAAAACATTTTTGGTATTTGTAGCTCATATATTTTATATCTATGTTTATGAAAGGGTTGTGATGCATCAATCTTGTTGAATA
CCACTTCTACGATCACAAGTGAGCAAACAGCTTTTGGAAATAACAACTCAATAAGAGGTTTAGATGTTGTGAATCAAATCAAAACAGCAGTGGAAAATGCTTGTCCTAACACTGTTTCTT
GTGCTGATATTCTTGCTCTTGCTGCTGAAATTTCCTCTGTTCTG
GTATGTTCCATATCTTCTTTGTTCCATTTCCATTTTTTCTAGTTCTAGTTTGCAAAAACAACAACACTGTAATAAA
AAAGCAGTCAAAGATGAGTTGAGAATCCTTGCCATAAAAAAAAGTTATGTTGGAAGAACTATTTTCTTCTTTGTTTTTAACATGAAAGTGACATAAAAAAAGGAAAAAAAAAAGTATTAA
AGTGTCATACTACAAACACAAAATTATTTGTCGGTTTTTCCTCACGGAAAATTATTTGTACAATTTAATTGTTATTCTTTCGATCTCATAATGAGTTTCTTAGATTTTTTATTGTTTATT
TTCAAACACCTAGGAACAAACTTCTTAATCCATTTCATAATGAGATGTTTTAAAAAAAATAAAAAATTGTTTTAAAATAATACCACTTTACATTTTTGATATAATTTTTTTTCCAACTTT
ACCATTAATAAATACTTCAATTTTTCTCTTTCTCACTATTTCCAATGTAACTTTAAGTTTGTCTTTTTCGCATAAAGTTAGGATAATTTAGTAAAAGTGTTATGTCTATTGATTATTTTA
TTCAATTTCTTAATTTGTGCGTCAAAACCTTAAATGACACTCGTTGTAAAACTGAGTGAGTATATAAAAGAAAATGAATAAAATTATACTAAATTATGTTAGTAAGCATTGGTGCAAATT
TTTTCTTACAAGGTTGACATTTTTTTTTTCATTAAATATTTTCTTTGTGAAGAATTTTTAACATGTGTCTTAAGGGCACATGGACTTAACATGACCCTTATCATAAATGCAAATAAAAAA
TAATACTAATAATTTATAAGCAATACATAATTAGAGGGTATAATTAAAAAATAATAATAATTTAATTTACAATAAGAATTAAAAATAACATTCATTTTAGGTTAGTTGTTTACAAATGTA
AACTTTATTTTATCTTTCCTTTCTTTTACTCTTTATTTAGCTCAATCCTCATTTATTCTAGTAACATAATTTGCAGGCTAATGGTCCTGATTGGAAAGTGCCATTAGGAAGAAGAGATAG
TTTAACAGCAAATCTAACCCTTGCTAATATAAATCTTCCAAGTCCAGCTTTCAACCTTACTCAACTGAAATCTAACTTTGATAATCAAGGTCTCGACGCTACAGATCTAGTTGCACTTTC
AG
GTATAGAAATGTTTCCTAAATTAGAGAAATTATTATTAATACACCATTTTACAAATGAGATTTGAACTCGGTTCGTTAAGGGTGATATACCTCATGATGTATGTATATGTGTGTATCT
AATTGTATATATGTTTTGGTAAATTTTTAGGTGCTCATACAATCGGTAGAGGTCAATGCAGATTCTTCGTTGATCGATTATACAATTTCAGCAATACTGGAAATCCCGATCCAACTCTCA
ACACAACCTACTTACAAACATTGAGAACTATATGTCCCAATGGTGGACCTGGTAGCACCCTAACCGATCTGGACCCAGCCACTCCAGATACATTCGACTCGGCCTACTACTCAAACCTAA
GGATTCAAAAAGGCTTGTTTCAGAGTGACCAAGTATTGTCTTCCACAAGTGGCGCGGACACGATTGCCATTGTCAACAGTTTCAACAACAACCAAACTCTTTTCTTTGAAGCTTTTAAGG
CCTCGATGATTAAAATGAGTAGAATTAAAGTGTTAACTGGATCTCAAGGTGAAATTAGAAAACAATGTAACTTTGTTAATGGAAATTCTGGCCTTGCCACAAAAGTCACAAGAGAGTCGT
CAGAGGATGGTATTGTTAGCTCATACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAACTCTTTCAATCTCTCTTTGGCAGCTTTGTGCTGTGTAGTAGTTGTGCTTGGAGGGTTACCCTTCTCATCAAATGCACAACTTGATAATTCCTTCTATAGGGACACTTGTCCTAATG
TTCATTCCATTGTTCGTGAAGTACTAAGAAATGTTTCTAAGACAGATCCTCGTATACTTGCTAGTTTGATAAGGCTTCACTTCCATGATTGCTTTGTTCAA
GGTTGTGATGCATCAATCT
TGTTGAATACCACTTCTACGATCACAAGTGAGCAAACAGCTTTTGGAAATAACAACTCAATAAGAGGTTTAGATGTTGTGAATCAAATCAAAACAGCAGTGGAAAATGCTTGTCCTAACA
CTGTTTCTTGTGCTGATATTCTTGCTCTTGCTGCTGAAATTTCCTCTGTTCTG
GCTAATGGTCCTGATTGGAAAGTGCCATTAGGAAGAAGAGATAGTTTAACAGCAAATCTAACCCTTG
CTAATATAAATCTTCCAAGTCCAGCTTTCAACCTTACTCAACTGAAATCTAACTTTGATAATCAAGGTCTCGACGCTACAGATCTAGTTGCACTTTCAG
GTGCTCATACAATCGGTAGAG
GTCAATGCAGATTCTTCGTTGATCGATTATACAATTTCAGCAATACTGGAAATCCCGATCCAACTCTCAACACAACCTACTTACAAACATTGAGAACTATATGTCCCAATGGTGGACCTG
GTAGCACCCTAACCGATCTGGACCCAGCCACTCCAGATACATTCGACTCGGCCTACTACTCAAACCTAAGGATTCAAAAAGGCTTGTTTCAGAGTGACCAAGTATTGTCTTCCACAAGTG
GCGCGGACACGATTGCCATTGTCAACAGTTTCAACAACAACCAAACTCTTTTCTTTGAAGCTTTTAAGGCCTCGATGATTAAAATGAGTAGAATTAAAGTGTTAACTGGATCTCAAGGTG
AAATTAGAAAACAATGTAACTTTGTTAATGGAAATTCTGGCCTTGCCACAAAAGTCACAAGAGAGTCGTCAGAGGATGGTATTGTTAGCTCATACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGACACTTAA GTCTAAGCTC AAAACAAGAG AAAAATAATG AACTCTTTCA ATCTCTCTTT GGCAGCTTTG TGCTGTGTAG TAGTTGTGCT TGGAGGGTTA CCCTTCTCAT CAAATGCACA  ACTTGATAAT TCCTTCTATA GGGACACTTG TCCTAATGTT CATTCCATTG TTCGTGAAGT ACTAAGAAAT GTTTCTAAGA CAGATCCTCG TATACTTGCT AGTTTGATAA GGCTTCACTT  CCATGATTGC TTTGTTCAAG GTTGTGATGC ATCAATCTTG TTGAATACCA CTTCTACGAT CACAAGTGAG CAAACAGCTT TTGGAAATAA CAACTCAATA AGAGGTTTAG ATGTTGTGAA  TCAAATCAAA ACAGCAGTGG AAAATGCTTG TCCTAACACT GTTTCTTGTG CTGATATTCT TGCTCTTGCT GCTGAAATTT CCTCTGTTCT GGCTAATGGT CCTGATTGGA AAGTGCCATT  AGGAAGAAGA GATAGTTTAA CAGCAAATCT AACCCTTGCT AATATAAATC TTCCAAGTCC AGCTTTCAAC CTTACTCAAC TGAAATCTAA CTTTGATAAT CAAGGTCTCG ACGCTACAGA  TCTAGTTGCA CTTTCAGGTG CTCATACAAT CGGTAGAGGT CAATGCAGAT TCTTCGTTGA TCGATTATAC AATTTCAGCA ATACTGGAAA TCCCGATCCA ACTCTCAACA CAACCTACTT  ACAAACATTG AGAACTATAT GTCCCAATGG TGGACCTGGT AGCACCCTAA CCGATCTGGA CCCAGCCACT CCAGATACAT TCGACTCGGC CTACTACTCA AACCTAAGGA TTCAAAAAGG  CTTGTTTCAG AGTGACCAAG TATTGTCTTC CACAAGTGGC GCGGACACGA TTGCCATTGT CAACAGTTTC AACAACAACC AAACTCTTTT CTTTGAAGCT TTTAAGGCCT CGATGATTAA  AATGAGTAGA ATTAAAGTGT TAACTGGATC TCAAGGTGAA ATTAGAAAAC AATGTAACTT TGTTAATGGA AATTCTGGCC TTGCCACAAA AGTCACAAGA GAGTCGTCAG AGGATGGTAT  TGTTAGCTCA TACTAAGTAA TTTAATACAA GTTGCATAAG AAAGGTACCT AATAAAGAGT GTGTTCTAGA GGCACATACA TGTTGTGCTC TTGTGGTGGA TGGCGATAGG TTTCTACTTT  GTAAACTATG GCCATTGATG TAGTGTTTGT ATTAACTATT TTCCTCTATT ATGATAATTA TGTTTCTTAT ATTATTGATA ATGATGATGA GATATGGTAG GGATATTGAA GTATTTAGGC 
TT 

Retrieve as FASTA