Entry information : CsAPx05
Entry ID 3426
Creation 2006-07-28 (Felipe Teixeira)
Last sequence changes 2012-01-04 (Felipe Teixeira)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang Li)
Peroxidase information: CsAPx05
Name CsAPx05
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation Thylakoid-bound
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsAPx05
start..stop
S start..stop
CclAPx02 771 0 1..393 1..395
VvAPx06 674 0 25..393 40..424
GmAPx07 667 0 25..393 54..432
InAPx06 657 0 7..393 20..423
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 442901..442972 72 N° 2 443036..443068 33 N° 3 443160..443294 135 N° 4 443549..443669 121
N° 5 443742..443842 101 N° 6 443927..444014 88 N° 7 444953..445020 68 N° 8 445103..445189 87
N° 9 445354..445428 75 N° 10 445531..445608 78 N° 11 445689..445793 105 N° 12 446296..446361 66
N° 13 446666..446818 153  
join(442901..442972,443036..443068,443160..443294,443549..443669,443742..443842, 443927..444014,444953..445020,445103..445189,445354..445428,445531..445608,44568 9..445793,446296..446361,446666..446818)


exon

Literature and cross-references CsAPx05
Literature Uratsu,S.L., Fisk,H.J. and Dandekar,A.M. Analysis of peel specific genes in Citrus. Unpublished (2003).
DNA ref. Phytozome 12:   scaffold00004 (442901..446818)
Cluster/Prediction ref. UniGene:   Csi.4511
Protein sequence: CsAPx05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   393
PWM (Da):   %s   42744.79 Transmb domain:   %s   o373-392i
PI (pH):   %s   7.49
Sequence 434
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSLSTAASSRLLCSTTAAAAAAKCLRFSPLISQRRSSVNRGYSTVPTTKCAASDPDQLKSAREDIRELLKSTFCHPILVRLGWHDAGTYDKNIEEWPRRGGANASLRFEVELKHAANAGLVNALKLIQPIKDKYSGVTYADLFQLASATAIEEAGGPKIPMKYGRVDVSGPEQCPEEGRLPAAGPPSPAEHLRNVFYRMGLNDKEIVALSGAHTVGRSRPERSGWGKPETKYTKDGPGAPGGQSWTVQWLKFDNSYFKDIKERRDEDLLVLPTDAVLFEDPSFKVYAEKYAEDQEAFFKDYAEAHAKLSNLGAKFDPPEGIVLDDGAAPEKFVAAKYSSGKSELSEAMKQKIRAEYEAVGGSPDTPLRSNYFLNIMIVVAVLALLTSLFGN

Retrieve as FASTA  
Remarks Probably produced by alternative splicing (CsAPx05 Stromal form). Complete sequence from genomic and 17 ESTs. No prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTCCTCTTTGAGCACCGCCGCTTCTTCTCGCCTTCTTTGCTCCACCACCGCAGCCGCCGCCGCAGCTGCTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAAATGCCTCAGATTCTCTCCTCTCATTAGCCAGGTAACTTTTATCGAGTGTGTTTTTTTATTCTATTTTGTATTTTCTTTTGCGTAACATGTAGTTTTATCTTCTT
CTTTTTTTTGGATTGCAGAGGAGATCGTCTGTGAACAGAGGATATAGCACCGTACCTACGACGAAATGTGCGGCGTCGGATCCTGATCAGTTGAAGAGTGCTAGAGAAGATATTAGGGAG
CTTCTCAAGTCTACATTTTGCCATCCTATTTTG
GTACATATGCGAATGTGAACCCTCTTTGAATTTCTGAATTGCATTATTGATGTGCTGTCTTTGTTAGTTTGGAGATAGAAGTTTTGG
AATTGAATTTTTGTGTAAACTCAATGTTTAGTTCTATAATTAACATTGCGCAAGAATGAAAAATAAAGCGTATACTGACCAAGTCTAGTTGATGAAATGGAACTATTCAGTAGTTTTAAG
TGTTTACAGCTTCTTGTGTATGATGATATTAATAACAGTAATAACAGGTTCGTCTAGGATGGCATGATGCTGGTACTTATGACAAGAACATTGAGGAGTGGCCTCGAAGGGGAGGAGCTA
ATGCAAGTCTTAGATTTGAGGTTGAGCTAAAACACGCAGCCAATGCTG
GTAATGATATGAACATTTTTGTGTAATTGAGCTTGTTTTGAAGATTTGGCACCTCACAACCTTGCATTTCAG

GGCTTGTGAATGCATTGAAACTGATTCAACCTATCAAGGACAAATATTCCGGTGTCACATATGCAGACTTATTCCAGTTGGCTAGCGCTACTGCTATAGAG
GTCTGACTGATTCTTATTT
TGGAATTAATATGATTTCAATTAATTTGATCGTCTAAAGGTTCTATCAATTTCTCTGAAATTCAGGAAGCCGGGGGCCCCAAGATCCCAATGAAGTATGGAAGAGTGGATGTCTCAGGAC
CTGAGCAGTGCCCTGAAGAAGGAAGGCTTCCCG
GTAAATACACCTTTGATGTTTATAGAATTTGGCTTGGTATATTTTACCATGGCGCCTACATTAAACAAAATAACAGTTACTGTGCAG
CTGTTTGTATCATGGATTATTCATAGAAATTGTGTTGATTGATTGCTTGAGCATATGAACTTGTTGTGTCTGGTGTAGGACAATCTTTTCTATGAGAATCTTGTTGACATCTTGGGGACT
GAGGAGTGTAATTTGGTTAATTCAAAGTTTATCTCTGTTGTTCTTTGATGTAGGAGTGAACTTGTCGTGTCTGGTGTAGGAAAATCTTTTCTATTAGAATCTTGTTGACATCTTGGGGAC
TGAGGAGTGTAATTTGGTTAATTCAAAGTTTATCTCTGTTGTTCTTTGATGTGTGTTTGATAGTATAGAGGCCAAGCAATATTATTCATGGCATGAGGTTTATGTATGTGCTCAGACACA
TGTTTATACATTTGTGTGGATTGAGTGAGAAATATACTTAAGACACTTTGGTGGTTTGAAAAAGAATAAATAAATAAATAAAAAGTTGTATATTGAAGGTTTATATCTGCTGACATTTTG
GCAATTGATTGCTTAATGTGCTTGCAGCCCCATGACCTTGTCTATTCTCTGATGTATAATTTTGTGAGCATGATGTCTACTGTTTTATGGATTAGATGAGTATGAGTAGCTGTTTCCCCC
CATACTGGTGAATTTTGAAGTGTATGGTTGACTTTGTTTATTCTCCGATGTATAATTTTGTCAGTATGATGTCTACTGTTTTATGGATTAGATGAGTATTGAGTAGCTGTTTCCCCTCAT
ACTGGTGAATTTTGAAGTGTATGGTTGAGTTGTAGTTATTTGTGGTTTTTGTTTTCTTTCCCCTGCTTTTTTTCACACTTCGTCTTAAATGACTACGCAACTAAATTTTGAAGTGCTCAT
TTGGCATACAGCTGCTGGGCCTCCATCACCTGCTGAACATTTAAGAAATGTCTTTTATAGAATGGGATTAAATGACAAGGTAAGATAAACTGTAGGAAGACTTGGTTGTTCTTTTACCTC
AATAGGTTGTGATGTTTATTAAATAGTTCTTTGATCTGCAGGAAATAGTTGCCTTATCTGGTGCACACACAGTGGGAAGGTCTAGACCTGAACGAAGTGGTTGGGGCAAGCCAGAAACAA
AGTACACG
GTAAAAAGCCTCTTTAGTTGTTTGGGAGGTACCATAGAGAACCTTTCTAGTACTTCCTCTGAATTGTTTACTTCTGGATGACTCTACAATCTGATAATTATCTGCTACAGAG
AATATAGCTATAGCAATGAGCTAATTATTTAAGAAAATATATTGCATGACAGAAAGATGGACCAGGAGCACCTGGTGGGCAGTCCTGGACAGTACAATGGTTGAAATTTGACAACTCCTA
CTTCAAG
GTTTGAAGTCAGAACACTGTCTCTTCATATGCATCTGCTATAGTGAGAAATAGAGGGGATAAGTAAAAGCATATTCCGCTTGCTGACTGATTTATCTAACAGGATATTAAAGA
AAGAAGGGACGAAGATTTACTCGTGCTGCCTACTGATGCTGTTCTTTTTGAAGATCCTTCATTCAAG
GTAAATATTAACGAGATCTTAGTGTAAGATGGTGAAGTAGAATCATCATTTAT
AGCTAATAAACTTGGCGTAATTTACAGGTTTATGCTGAGAAATATGCTGAGGATCAGGAAGCATTCTTTAAGGATTATGCTGAAGCCCATGCCAAACTCAGCAACCTTGGGGCAAAATTT
GACCCTCCTGAG
GTATGTTAAGACTGCTTGTGTTAAGTGCTAATGTCAATGCAGCTTTTCTTTTGACTAGAAACACTCTGTCATTGTTCCTGAAAATTTTGAAAACATCCGGATTGAAGA
AATTTTTTTATTGTATTTAACTTATGAACTCATATTTTTCTCTTGCGAGATAGTTCAATTGGTTCTGTTATTGGCATTTATTTGAATAATTTTCATAATATTTGGAATAGCTCAGATGAG
TTTTCTTACAAACAAGCATATTTAGAGTGCCAAATAACTGCACATTTATCAATATTGTGTTTCTGGCTGAAAATGCCAAGTGAAATTTTAGTCTTTCTGTACTCTTCGGGCACGTGCATG
ACTGCATATTACCATCTCCAATTATTGGCATCAGCTGACAATCAGGATTTGACTTGTTAACTTTTAAGGAATCTGCATCAATAAATCTGTTGTGGAAGATTATGGTAAAAGGGATTAGTA
ATCTTTTAAACTGATTGTTGAATTTGGTGATCAGGGTATTGTGCTAGATGATGGTGCTGCTCCAGAGAAGTTTGTAGCAGCCAAGTATTCGTCCGGAAAGGTTGTAATTATATATTAACT
TATTTTTAAAAATTTCTTTTAGTTAATAGTAGTTGAAAATTCCTTGCATTTTTTATTTCCATAGTAATCGAGCTTGTGTATGTGCAAAATGTTTATCTTTTATACTCTTTATGATTTGAT
GCAGGACTGAAAAAACAAGTAACTTTGTTTTCTTGTGCCGTATGTTATAATAATACAAGATGAAGGTTTTTTGAAATCCTGTGTGTGCTTCACACCTAAAACTTGGAAGTCTAAGTGAAG
GTGAAAGAATAAAATTCAATTAGTGTTGGCTATTTGAATTGCAGAGTGAGCTGTCAGAGGCTATGAAGCAGAAGATACGGGCAGAGTATGAAGCCGTTGGTGGAAGCCCAGATACACCTC
TACGGTCAAACTATTTCCTGAATATTATGATTGTGGTTGCTGTTTTGGCACTTTTGACATCTCTCTTTGGAAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTCCTCTTTGAGCACCGCCGCTTCTTCTCGCCTTCTTTGCTCCACCACCGCAGCCGCCGCCGCAGCTAAATGCCTCAGATTCTCTCCTCTCATTAGCCAGAGGAGATCGTCTGTGA
ACAGAGGATATAGCACCGTACCTACGACGAAATGTGCGGCGTCGGATCCTGATCAGTTGAAGAGTGCTAGAGAAGATATTAGGGAGCTTCTCAAGTCTACATTTTGCCATCCTATTTTG
G
TTCGTCTAGGATGGCATGATGCTGGTACTTATGACAAGAACATTGAGGAGTGGCCTCGAAGGGGAGGAGCTAATGCAAGTCTTAGATTTGAGGTTGAGCTAAAACACGCAGCCAATGCTG
GGCTTGTGAATGCATTGAAACTGATTCAACCTATCAAGGACAAATATTCCGGTGTCACATATGCAGACTTATTCCAGTTGGCTAGCGCTACTGCTATAGAGGAAGCCGGGGGCCCCAAGA
TCCCAATGAAGTATGGAAGAGTGGATGTCTCAGGACCTGAGCAGTGCCCTGAAGAAGGAAGGCTTCCCG
CTGCTGGGCCTCCATCACCTGCTGAACATTTAAGAAATGTCTTTTATAGAA
TGGGATTAAATGACAAG
GAAATAGTTGCCTTATCTGGTGCACACACAGTGGGAAGGTCTAGACCTGAACGAAGTGGTTGGGGCAAGCCAGAAACAAAGTACACGAAAGATGGACCAGGAG
CACCTGGTGGGCAGTCCTGGACAGTACAATGGTTGAAATTTGACAACTCCTACTTCAAG
GATATTAAAGAAAGAAGGGACGAAGATTTACTCGTGCTGCCTACTGATGCTGTTCTTTTTG
AAGATCCTTCATTCAAG
GTTTATGCTGAGAAATATGCTGAGGATCAGGAAGCATTCTTTAAGGATTATGCTGAAGCCCATGCCAAACTCAGCAACCTTGGGGCAAAATTTGACCCTCCTG
AG
GGTATTGTGCTAGATGATGGTGCTGCTCCAGAGAAGTTTGTAGCAGCCAAGTATTCGTCCGGAAAGAGTGAGCTGTCAGAGGCTATGAAGCAGAAGATACGGGCAGAGTATGAAGCCG
TTGGTGGAAGCCCAGATACACCTCTACGGTCAAACTATTTCCTGAATATTATGATTGTGGTTGCTGTTTTGGCACTTTTGACATCTCTCTTTGGAAATTAG

Retrieve as FASTA