Entry information : PpaPrx28 (Pp3c2_28900V3 [3.3])
Entry ID 3439
Creation 2010-01-27 (Christophe Dunand)
Last sequence changes 2012-01-05 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-02 (Achraf Jemmat)
Peroxidase information: PpaPrx28 (Pp3c2_28900V3 [3.3])
Name (synonym) PpaPrx28 (Pp3c2_28900V3 [3.3])
Class Class III peroxidase    [Orthogroup: Prx207]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx28
start..stop
S start..stop
PpaPrx54 659 0 1..326 1..326
PtaPrx123 304 4e-103 17..324 9..320
MpalPrx170 296 5e-100 4..323 8..329
MePrx79 296 8e-100 34..325 26..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 906921..907166 246 N° 2 907340..907519 180 N° 3 907651..907807 157 N° 4 907926..908323 398
join(906921..907166,907340..907519,907651..907807,907926..908323)


exon

Literature and cross-references PpaPrx28 (Pp3c2_28900V3 [3.3])
Literature Fujita,T., Nishiyama,T., Shin-i,T., Kohara,Y. and Hasebe,M. Physcomitrella patens EST at a stage of the first asymmetric cell division of protoplasts. Unpublished (2005).
DNA ref. Phytozome 12:   chr02 (19484019..19486456)
Protein sequence: PpaPrx28 (Pp3c2_28900V3 [3.3])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (305)
PWM (Da):   %s   33421.43 (33320.9)  
PI (pH):   %s   4.29 (6.78) Peptide Signal:   %s   cut: 25 range:25-329
Sequence 367
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSRSTKIGSDSQAPAPWLLTILIASSIAVQHVVHGAVQVGFYDATCSAAESIVKGAVQSAVALDGTIAASIIRLHFHDCFAQGCDASIMLTGTGSERDAPPNLSVRGYGVINDAKAQLESSCPGVVSCADIIALAARDSVEILGGATYGAETGRFDGAAPAASVNIPSPNSAVAEATPFFTNLGLTQDDMVNLLGAHTVGVSQCQFFVDRLYNFQGTGLPDPSLDATYLAVLQSRCPNVAGDVTTVALDQGSESSFDTGYFTNIQASKGVLRIDQEIANDASTSGRVNTLAASPSTFGTDFATSMIAMGRIAVLTSGSVRSDCETA

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST. Tandem duplication in opposite orientation with 100% of identity at the nucleotide level).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCGAGATCGACGAAAATTGGTAGTGACAGTCAGGCTCCTGCTCCCTGGCTTCTCACCATACTGATCGCTTCTTCGATCGCGGTCCAGCACGTGGTCCACGGGGCCGTCCAGGTGGGGT
TCTACGACGCAACATGCAGCGCTGCTGAATCCATTGTGAAGGGTGCGGTGCAATCGGCTGTCGCCTTGGATGGGACCATCGCTGCCAGTATCATTCGCTTGCACTTCCACGACTGCTTCG
CTCAG
GTACGAGGATCCTGGCACCGGAACCCAGAAATCCATGTGGCGAACTTCACCGCTTCCCGCACACGATGTGTTCCTTGCCGGCTGCATTCAGAAAGAATTGGGGCGCAATCATGGT
GGATTGCCCATTGCTGTGTGTTTGCTAATTGTTCCCAAATTCTGTCGGGCCGCTTCAGGGTTGCGATGCATCCATCATGCTCACCGGAACGGGCTCGGAGCGAGATGCACCGCCGAACCT
ATCTGTGAGAGGCTACGGCGTCATCAACGATGCCAAAGCTCAGCTGGAATCCAGTTGCCCAGGAGTGGTTTCCTGTGCCGACATAATCGCCCTTGCTGCGCGAGACTCTGTCGAAATC
GT
AAGCCACCATCGCTCCACAGAATCCGACACTATGAATGTCCGCAGTTGTATCCACATCCACATCCCCTGCTCTTGCCGCGCTTGTAGCTCATTTGCCGACGGCTCATCCCTGCCGATTCA
CTTGCGCAGCTAGGTGGAGCCACGTACGGTGCAGAAACTGGGCGCTTCGATGGCGCTGCTCCCGCCGCAAGTGTGAACATACCGTCCCCGAACTCCGCTGTGGCGGAGGCCACTCCATTC
TTCACCAATCTTGGCCTCACGCAGGACGACATGGTCAACCTTCTTG
GTAATGTTGTCAATCATGATCCCGCCTCCAGCAAATCATTTGCGTGTCTGTCCAGAGCGACCTCGGGCCCTCGT
CGTGGCCAACCTGGGATGCTAAAGTTTGGTTCTGGTGTGGACAGGTGCGCACACCGTCGGCGTCTCGCAGTGCCAGTTTTTCGTCGACCGCTTGTACAACTTCCAGGGCACCGGTTTGCC
CGATCCCAGCCTGGACGCGACGTATTTGGCCGTGCTTCAGTCTCGCTGCCCAAACGTGGCCGGCGACGTGACCACCGTGGCCCTGGACCAAGGTTCCGAGTCGTCCTTCGACACCGGCTA
CTTCACCAACATCCAGGCGAGCAAAGGAGTTCTTCGGATCGACCAGGAGATTGCAAACGACGCCAGCACGAGCGGGAGAGTTAACACCCTCGCTGCCTCCCCGTCCACCTTTGGCACAGA
CTTCGCGACCTCCATGATTGCAATGGGGAGGATCGCCGTGCTCACTTCTGGAAGCGTCCGCTCCGACTGCGAGACAGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCGAGATCGACGAAAATTGGTAGTGACAGTCAGGCTCCTGCTCCCTGGCTTCTCACCATACTGATCGCTTCTTCGATCGCGGTCCAGCACGTGGTCCACGGGGCCGTCCAGGTGGGGT
TCTACGACGCAACATGCAGCGCTGCTGAATCCATTGTGAAGGGTGCGGTGCAATCGGCTGTCGCCTTGGATGGGACCATCGCTGCCAGTATCATTCGCTTGCACTTCCACGACTGCTTCG
CTCAG
GGTTGCGATGCATCCATCATGCTCACCGGAACGGGCTCGGAGCGAGATGCACCGCCGAACCTATCTGTGAGAGGCTACGGCGTCATCAACGATGCCAAAGCTCAGCTGGAATCCA
GTTGCCCAGGAGTGGTTTCCTGTGCCGACATAATCGCCCTTGCTGCGCGAGACTCTGTCGAAATC
CTAGGTGGAGCCACGTACGGTGCAGAAACTGGGCGCTTCGATGGCGCTGCTCCCG
CCGCAAGTGTGAACATACCGTCCCCGAACTCCGCTGTGGCGGAGGCCACTCCATTCTTCACCAATCTTGGCCTCACGCAGGACGACATGGTCAACCTTCTTG
GTGCGCACACCGTCGGCG
TCTCGCAGTGCCAGTTTTTCGTCGACCGCTTGTACAACTTCCAGGGCACCGGTTTGCCCGATCCCAGCCTGGACGCGACGTATTTGGCCGTGCTTCAGTCTCGCTGCCCAAACGTGGCCG
GCGACGTGACCACCGTGGCCCTGGACCAAGGTTCCGAGTCGTCCTTCGACACCGGCTACTTCACCAACATCCAGGCGAGCAAAGGAGTTCTTCGGATCGACCAGGAGATTGCAAACGACG
CCAGCACGAGCGGGAGAGTTAACACCCTCGCTGCCTCCCCGTCCACCTTTGGCACAGACTTCGCGACCTCCATGATTGCAATGGGGAGGATCGCCGTGCTCACTTCTGGAAGCGTCCGCT
CCGACTGCGAGACAGCTTGA

Retrieve as FASTA