Entry information : MtPrx19 ( Medtr1g077000.1[4.0] / Medtr7g035030{3.5] / Medtr7g035100.1[3.0])
Entry ID 347
Creation 2006-01-24 (Christophe Dunand)
Last sequence changes 2016-04-07 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-04-07 (Christophe Dunand)
Peroxidase information: MtPrx19 ( Medtr1g077000.1[4.0] / Medtr7g035030{3.5] / Medtr7g035100.1[3.0])
Name (synonym) MtPrx19 ( Medtr1g077000.1[4.0] / Medtr7g035030{3.5] / Medtr7g035100.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx026]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Roots
Seedlings
Inducers Aphanomyces euteiches zoospores infection
Glomus versiforme infection
Pathogen interaction
UV irradiation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx19
start..stop
S start..stop
PvPrx09 539 0 1..327 1..326
GmPrx14 533 0 14..327 1..314
GmPrx65 529 0 1..327 1..328
LjPrx25 521 0 14..327 1..313
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 34365800..34366051 252 N° 2 34366678..34366866 189 N° 3 34367091..34367253 163 N° 4 34367358..34367737 380
join(34365800..34366051,34366678..34366866,34367091..34367253,34367358..34367737 )


exon

Literature and cross-references MtPrx19 ( Medtr1g077000.1[4.0] / Medtr7g035030{3.5] / Medtr7g035100.1[3.0])
Literature Watson,B.S. et al., unpublished
Protein ref. UniProtKB:   A0A072VLG5
DNA ref. Phytozome 12:   chr7 (34365800..34367737)
EST ref. GenBank:   EV258250.1 [5' end]   BQ154684.1 [3' end]
Cluster/Prediction ref. Phytozome Gene 12:   31099440 UniGene:   Mtr.11047
Omic ref. Gene atlas:   Mtr.43914.1.S1_at Legoo:   Mtr.43914.1.S1_at
Protein sequence: MtPrx19 ( Medtr1g077000.1[4.0] / Medtr7g035030{3.5] / Medtr7g035100.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328
PWM (Da):   %s   36248.73 Transmb domain:   %s   i13-35o
PI (pH):   %s   6.5
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMYTSSMKSLKMVMVKLMTFFMLIEVITCQFGFGFGGGLNMNYYLMSCPFVEPVVKNIVNRALDNDPTLAAALIRMHFHDCFIQGCDGSILLDSTKDNTAEKDSPANLSLRGYEVIDDIKDELENRCPGVVSCADILAMAATEAVFYAGGPVYNIPKGRKDGRRSKIEDTRNLPSPSFNASELITQFGQHGFSAQEMVALSGAHTLGVARCSSFKNRLSQVDPALDTEFARTLSRTCTSGDNAEQPFDATRNDFDNVYFNALLRKNGVLFSDQTLYSSPRTRNIVNAYAMNQAMFFLDFQQAMVKMGLLDIKQGSNGEVRSNCRKIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 3 introns) and 11 ESTs. Cultivar="A17".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGTATACATCATCTATGAAGTCATTGAAAATGGTAATGGTTAAATTGATGACATTTTTTATGCTAATAGAGGTGATTACATGCCAATTCGGGTTCGGATTCGGGGGAGGGTTAAAC
ATGAACTACTATTTGATGAGTTGCCCTTTTGTTGAACCAGTTGTTAAGAACATAGTGAATAGAGCTTTGGACAATGATCCCACCCTTGCAGCTGCTCTTATAAGAATGCACTTCCATGAC
TGCTTCATACAG
GTTCTCTCTCTTTCTCTCCCTCTCTCTCTACATTCTAGCATGAGACACTCAAACACATGGTGGATGCATGATGATGTTGCATGCGTACATGCATGGTCCACTTGGAAA
TTAATGTTTTATAGTATACATTCAAATTAGTTGTAATGCAAGTTTTGATAAATTTTTGATAGATCTGATGCCATCTTATAATTTTGGATTAGGTTTAATTGAGTGAAGATTAGGTCTGCA
CTTTTTTTTTTGGTGTCCAGGGTTCAAACCTCAGACCTTGCATATGTTATGCACTGTCTTTATCAACTGAACTAAGCTCAAAGGGACGATTAGGTCTGCACTTATAAACATATATTCATA
TCATAAAGTGCAAAGTATCATTCATCTTTCAAATATTGTTAATATCATTAATTTCTTAGAACGTGAGTAGCCATGTCAATACGACGTCAGTGGTTGCTCAACTATTTATTGTCGCAAAAA
TGTCCACCGTATGTGGTGTCGTGCAATATTATGTCATCAATCAACTACAACTATAGGACAAACAAACTTTATCAATGTATTGCTTCCATTTTCTACATTATATAGTTTATTCACGTTAAC
ATATGTGACATTAATATTTGTTTATTTTTGTCCACTAGGGATGTGATGGGTCAATTCTGCTTGATTCCACTAAGGATAATACAGCAGAAAAGGATTCACCAGCAAATTTGAGCCTAAGAG
GATATGAAGTCATTGATGATATCAAAGACGAGCTTGAAAACCGATGCCCTGGCGTGGTTTCATGTGCTGATATTCTTGCTATGGCTGCCACCGAAGCAGTTTTCTAC
GTAAGATATATAA
TTACTTGTCTTAATGGATTAAATATATTTTTCGTCTCTACAAATATATACAGTTTCGTTTTTAGTTCCTACAAAATAAATTGTTCAAATTTTAGTCCTTGATAACTATAACGCCATGTCT
GCCTGGCAAGTGTCATGTGATTGATTGATATAAAATTTGGCTTGAACATGAAATTGATTTTCATAAACAAATGAAACATTGAATATTGCAGGCTGGAGGTCCGGTCTATAACATACCTAA
AGGTAGAAAGGATGGAAGAAGATCAAAAATAGAGGACACTAGAAATTTGCCATCCCCGTCTTTTAATGCATCCGAGCTCATCACGCAGTTTGGTCAACATGGTTTTTCTGCACAAGAGAT
GGTCGCTCTCTCCG
GTAACAACATACTAACTATATACTCCGTTTGTAATTATAAACAAAAATGAGTCAAAAAAAGTCGATGTATTATATTGAGGTCCTGAATTGTATATTATATGCAGGG
GCACATACACTAGGAGTGGCAAGGTGTTCTTCATTCAAGAACAGATTGAGCCAAGTGGATCCAGCTTTGGATACAGAATTTGCCAGGACACTATCAAGAACATGTACTTCTGGTGACAAT
GCAGAACAACCATTCGATGCAACAAGGAACGATTTTGACAATGTTTACTTCAACGCTTTGTTGAGGAAAAATGGTGTTTTGTTTTCAGATCAAACACTCTACTCTAGCCCTAGAACAAGG
AACATTGTGAATGCTTATGCAATGAACCAAGCCATGTTCTTCCTAGATTTTCAACAAGCTATGGTGAAGATGGGTTTGCTTGATATTAAACAAGGTTCCAATGGTGAAGTGAGATCAAAT
TGCCGCAAAATAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGTATACATCATCTATGAAGTCATTGAAAATGGTAATGGTTAAATTGATGACATTTTTTATGCTAATAGAGGTGATTACATGCCAATTCGGGTTCGGATTCGGGGGAGGGTTAAAC
ATGAACTACTATTTGATGAGTTGCCCTTTTGTTGAACCAGTTGTTAAGAACATAGTGAATAGAGCTTTGGACAATGATCCCACCCTTGCAGCTGCTCTTATAAGAATGCACTTCCATGAC
TGCTTCATACAG
GGATGTGATGGGTCAATTCTGCTTGATTCCACTAAGGATAATACAGCAGAAAAGGATTCACCAGCAAATTTGAGCCTAAGAGGATATGAAGTCATTGATGATATCAAA
GACGAGCTTGAAAACCGATGCCCTGGCGTGGTTTCATGTGCTGATATTCTTGCTATGGCTGCCACCGAAGCAGTTTTCTAC
GCTGGAGGTCCGGTCTATAACATACCTAAAGGTAGAAAG
GATGGAAGAAGATCAAAAATAGAGGACACTAGAAATTTGCCATCCCCGTCTTTTAATGCATCCGAGCTCATCACGCAGTTTGGTCAACATGGTTTTTCTGCACAAGAGATGGTCGCTCTC
TCCG
GGGCACATACACTAGGAGTGGCAAGGTGTTCTTCATTCAAGAACAGATTGAGCCAAGTGGATCCAGCTTTGGATACAGAATTTGCCAGGACACTATCAAGAACATGTACTTCTGGT
GACAATGCAGAACAACCATTCGATGCAACAAGGAACGATTTTGACAATGTTTACTTCAACGCTTTGTTGAGGAAAAATGGTGTTTTGTTTTCAGATCAAACACTCTACTCTAGCCCTAGA
ACAAGGAACATTGTGAATGCTTATGCAATGAACCAAGCCATGTTCTTCCTAGATTTTCAACAAGCTATGGTGAAGATGGGTTTGCTTGATATTAAACAAGGTTCCAATGGTGAAGTGAGA
TCAAATTGCCGCAAAATAAACTAA

Retrieve as FASTA