Entry information : MtPrx27 (Medtr2g040000.1[4.0] / Medtr2g040000[3.5] / Medtr2g046610.1[3.0])
Entry ID 352
Creation 2005-06-16 (Christophe Dunand)
Last sequence changes 2010-09-30 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx27 (Medtr2g040000.1[4.0] / Medtr2g040000[3.5] / Medtr2g046610.1[3.0])
Name (synonym) MtPrx27 (Medtr2g040000.1[4.0] / Medtr2g040000[3.5] / Medtr2g046610.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx237]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Roots
Inducers Glomus versiforme infection
Phosphate starvation
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx27
start..stop
S start..stop
LjPrx47 502 0 14..332 1..316
GmPrx183 498 1e-179 1..331 1..327
GmPrx288 455 2e-162 1..332 1..332
GmPrx235 450 1e-160 11..332 12..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 17549459..17549680 222 N° 2 17547655..17547840 186 N° 3 17547360..17547525 166 N° 4 17545733..17546157 425
complement(join(17545733..17546157,17547360..17547525,17547655..17547840,1754945 9..17549680))


exon

Literature and cross-references MtPrx27 (Medtr2g040000.1[4.0] / Medtr2g040000[3.5] / Medtr2g046610.1[3.0])
Literature Harrison, M.J. et al., unpublished, Fedorova,M. et al., unpublished
DNA ref. Phytozome 12:   chr2 (17549680..17545733)
Cluster/Prediction ref. Phytozome Gene 12:   31063844 UniGene:   Mtr.9446
Omic ref. Gene atlas:   Mtr.37599.1.S1_at Legoo:   Mtr.37599.1.S1_at
Protein sequence: MtPrx27 (Medtr2g040000.1[4.0] / Medtr2g040000[3.5] / Medtr2g046610.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (310)
PWM (Da):   %s   36948.16 (34462.0)  
PI (pH):   %s   4.62 (4.49) Peptide Signal:   %s   cut: 23 range:23-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNKSCRAIACFWLMSFLNLSVAEPMSPKLTPYFYRTTCPDVFTIVRREVLNAINEEIRMAASLLRLHFHDCFVNGCDASILLDGDEDIEKFATPNINSARGFEVIDRIKSSVESSCSGVVSCADILAIVARDSVHLSGGPFWYVQLGRRDGLVSNKTLANNAIPSPFDSLDTIISKFDNVGLSVKDVVTLSGAHTIGRARCTFFSNRLFNFSGTQEPDNSLEYEMLTELQNLCPQDGDGNTTTVLDPYSFDQFDNNYFKNLLNGKGLLSSDQILFSSDEETTSTTKQLVQYYSENERIFFMEFAYAMIKMGNINPLIGSEGEIRKSCRVINS

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns) and 9 ESTs (Sequencing error at position 24 (extra G)).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATAAATCATGTAGAGCTATTGCATGTTTTTGGCTTATGAGTTTCTTAAATTTGAGTGTGGCTGAACCTATGAGCCCTAAACTGACCCCATATTTTTACAGGACAACGTGCCCTGAT
GTTTTTACAATAGTTAGAAGAGAGGTTCTTAATGCAATAAATGAAGAGATTCGAATGGCTGCTTCTTTGCTTCGTCTTCACTTTCATGATTGCTTTGTAAAT
GTAAGTAAGTTAGAGATA
CTAGTAGATTATTTTTATTTCTCATATAACAATATATACTTACCTACTTCAATAAAAGGCAAAATTACACTTTTAATCCCTTAACTTAATTTCAAGTAACAGTTTGGTCCTTTACCTTTT
TTTCATTTCAATTTGGTCTTTTTTATCCATTTTTATATACATTTTCAAGCTTCAAATCTAATATTCTTATGCAAACATAGACGAGGATCATAGATTTGAAGATTGAAAGACCATAAGAAA
ATAAAATCATGAATTTTAAACTTAAAAATTCATATGAAAATGGACAAAAAGGACCAAATTAAAATGAAAAAAAAGATAAAGGACTAAACTGTTACCTGAAATTAAGTTAAGGGACTAAAA
ATGTAATTTTTCCTCAATAAAACTATGCAATAATATTAAAACTAATTTTTTTATACATATCCAAATCTTATATAGCCGTAGGGTGATGTTATTACGATTAAAATTGTAAAAGTTGATAAA
TTAGAGAAATAGCAAAAAAAAAAAATAATGGACAAAATATCAACCAATTTTCTCAAATTTTGCACCACAAATTTTAAGAGACTATGTTTGGTTTGAGGCCAATTTATTGTGTATAGGTGA
GATAAGTCTTGCATCATTCATAAATCGGTTGATTCAATGGTGATATTTATTGATCTAAGGGTTAAATATGTTTTTGATTCCTATAAATAAATCAATTTTTCGTTTTACTCCTTCTAAAAT
TTTCCTTCAACTTTTAGTCCCTAAATTTTTTTCCATTTTCACTTTTGGTCCATTTTTTTAAAGTAAACTCATATGTAAAATTCATATTTTTGAATAAAATTTTGCAAATTTCATAATATT
ATAACAATCTCTCCAAAAAAAATTAGAATTTTTTAACAGAACATGAATTTAATATGAATTTTTATGGTTAAAAATTCATATTTAATTTATGTTTTGTTAAAAAAATATAATTTTTTTACA
ATATTCTACACATTTCTGCATAATATCATTAAAAAATAGTAAAATTAACTTAAAAATAGGGACCAAAAGTAGTGATTGAAAATTTTATAGGGACTAAAAGTCGAAGGAAAGTTTTAAAGG
GACTAAAACGAAAAGTTGATATATTTAAAGGGACAAAAAACATATTTAACCCTTGATCTAATGGTGAAAAACACACTTGTGTATGATACAATACTATTTTATTCATGCACATTAGACAAA
ATCTTGAGGAACTAAATTGATTGATATTTTTCTGTTTAGATACTAAGTTTCTATTCCTAATTTGAGGACTAGATTTAGCAACCTTTCATTTTTAAGGACCACGATGTCAATTTATACTCT
TTTTTTGGTGGTAGTCGGGGTTCGAACTCCAGACCTTGTATATATTATGAATTGTTCATACCAACTGACTTAAACTCATGAGAACCGTCAATTTATACTCTATTATTATAATATCATTTT
TTAAATTATTTATGCAAATATCTAATTAGATGCCTATGTAGGACGTTTTTATTGGAACGTACTCTTTTTTTTTATAAGCATTGGAATATAGTATTAAATTTCTATGCAGTACTCTCTCTC
TTTGATCTTTTTGTTTATCCAACATTTTTTTGGCTCTCAGGGTTGTGATGCTTCAATTCTGCTTGATGGAGACGAAGATATTGAGAAATTTGCTACTCCAAACATAAATTCAGCTAGAGG
ATTTGAAGTCATAGATAGAATCAAAAGTTCAGTGGAGAGTTCATGTAGTGGAGTTGTGTCTTGTGCTGATATATTAGCCATAGTTGCTAGAGATTCTGTTCACCTA
GTATGTTCAACTTC
AATTATTAAATATTCATAACTAATCATGCAAATATTAAAACAAATCTCTCTTTTAATTACAAAATTATTTTCTTAATTTGTGTTTAGCTTAATTAATTGTGATCATATTTTGTAGAGTGG
GGGTCCATTTTGGTACGTTCAGCTAGGACGCAGAGATGGATTGGTCTCAAACAAAACACTTGCAAATAATGCAATTCCTTCTCCATTTGACTCACTAGATACTATCATTTCCAAGTTTGA
TAACGTTGGTCTTAGTGTTAAAGATGTTGTTACTTTATCAG
GTATAATCCTATAGTTAAATAAATTATTTGAAATCTTATTTGTCAAAAAAGTTATATATATGGTCTTTTATTAAAGAAA
TTCAGATTAATTTAGAAATTTTTTGAAGAGTATTTTTTGAACATGATATGTTAATGAATTTAAGATAAGGGTGAATGAGTCACATTAGTTAAAGGATGGGTAAAAACTTTAATAAAGGAG
AACTATTAACGTAACAATTAATATATTAATGGATAAAATAATTAATAGTTTTTATCTTTGTAAGTGGGGTGAAAGAGAACAAAACCCTAAACTCCAATCAAACTCTTACAAATCCATAGC
TCACCACCAAGCTCCCACTTGAAAGATATTCTTGGGCGAGTTTATTTGGCACAACGGTTAAGTTGTTGTCACGTGACTAAAATATCAGGTTCAAATTTTGGAGATAACCTATTATATAAA
AAATTTGGTAAGGTTGCGTACATTACAAATTTTTTATTTATATGAGACCTCTTTTCGGACTCTATTTATGTGGTGCTTTAGTGCACCAGACTGTCTTTTTTATATTTGGACTTATTTTAT
GATATAAACACTTGTATGCGTGTTTAGAAGTGCTTATAAAAATAACTTAAGTTACTACATGTCTATAATTAATTGTTCTTATTTTCATAAACTTTCCCATATAGCTTATAGAAACAAAGA
ATATGATATAGTTAGTTGTAAGATATTTATATAGTACTTGTATCTTGTTTTCATCAAGTTTTTGAAATAATTTATAGCCCGTCTGGATTGACTTATTTTTGAACTTGTGAAAAATAATTT
ATGTAAATAAATAAATTTTTATGTTAGTTTATAAGTTTTCACTAACGAAAATGATATATTCATAAGTTGTTTTTTCATAAACTACCTTTATTTTTTTTGAAAGGTTTTCGTAAACTACCT
TGACAAGCCTATAAATAATACATAAAAATTTATTCAATTGTATAAGTTGTTTTATATAAACTCAAAAATAGGAAAATCCAAACGAACCTACAATCTTATGCTAAGTTTTTTTGTCATTTT
CTCTTCAATTGTTGCGTAAGTTCTTGATTAACTATGTAGCTAAAAAATTCCGATTCAATGTATTTTTTCCCATATATTAGAAAAAAAAGAATTATCTTGCTTACTTTTCCTCTAAATTGA
AATCTATTACCAATTTCTATTCATCCATTCTAATATTCTTTAGGTGCCCACACTATTGGACGAGCTAGGTGCACATTTTTTAGCAACAGATTATTCAACTTCTCTGGAACACAAGAACCA
GACAATTCTTTAGAATATGAAATGCTAACTGAATTGCAAAACTTGTGTCCACAAGATGGAGATGGTAACACAACTACTGTTCTTGACCCCTACTCATTTGATCAATTTGATAACAATTAC
TTCAAGAATTTACTTAATGGAAAGGGTCTCCTTAGCTCTGACCAAATTCTCTTTTCAAGTGATGAAGAAACCACTTCAACCACTAAACAATTGGTCCAATATTATAGTGAGAATGAAAGA
ATTTTTTTTATGGAATTTGCATATGCTATGATTAAGATGGGGAATATAAATCCACTTATTGGTTCTGAGGGAGAGATTAGAAAGAGCTGTAGAGTGATTAATTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATAAATCATGTAGAGCTATTGCATGTTTTTGGCTTATGAGTTTCTTAAATTTGAGTGTGGCTGAACCTATGAGCCCTAAACTGACCCCATATTTTTACAGGACAACGTGCCCTGAT
GTTTTTACAATAGTTAGAAGAGAGGTTCTTAATGCAATAAATGAAGAGATTCGAATGGCTGCTTCTTTGCTTCGTCTTCACTTTCATGATTGCTTTGTAAAT
GGTTGTGATGCTTCAATT
CTGCTTGATGGAGACGAAGATATTGAGAAATTTGCTACTCCAAACATAAATTCAGCTAGAGGATTTGAAGTCATAGATAGAATCAAAAGTTCAGTGGAGAGTTCATGTAGTGGAGTTGTG
TCTTGTGCTGATATATTAGCCATAGTTGCTAGAGATTCTGTTCACCTA
AGTGGGGGTCCATTTTGGTACGTTCAGCTAGGACGCAGAGATGGATTGGTCTCAAACAAAACACTTGCAAAT
AATGCAATTCCTTCTCCATTTGACTCACTAGATACTATCATTTCCAAGTTTGATAACGTTGGTCTTAGTGTTAAAGATGTTGTTACTTTATCAG
GTGCCCACACTATTGGACGAGCTAGG
TGCACATTTTTTAGCAACAGATTATTCAACTTCTCTGGAACACAAGAACCAGACAATTCTTTAGAATATGAAATGCTAACTGAATTGCAAAACTTGTGTCCACAAGATGGAGATGGTAAC
ACAACTACTGTTCTTGACCCCTACTCATTTGATCAATTTGATAACAATTACTTCAAGAATTTACTTAATGGAAAGGGTCTCCTTAGCTCTGACCAAATTCTCTTTTCAAGTGATGAAGAA
ACCACTTCAACCACTAAACAATTGGTCCAATATTATAGTGAGAATGAAAGAATTTTTTTTATGGAATTTGCATATGCTATGATTAAGATGGGGAATATAAATCCACTTATTGGTTCTGAG
GGAGAGATTAGAAAGAGCTGTAGAGTGATTAATTCTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCATT TGGTGGCTAT AAATACATCA ATTGTTAGGT ATTTGCCAAA TACATCTAAC TTAGTAACAA ACAAAGCAAA AATGAATAAA TCATGTAGAG CTATTGCATG TTTTTGGCTT  ATGAGTTTCT TAAATTTGAG TGTGGCTGAA CCTATGAGCC CTAAACTGAC CCCATATTTT TACAGGACAA CGTGCCCTGA TGTTTTTACA ATAGTTAGAA GAGAGGTTCT TAATGCAATA  AATGAAGAGA TTCGAATGGC TGCTTCTTTG CTTCGTCTTC ACTTTCATGA TTGCTTTGTA AATGGTTGTG ATGCTTCAAT TCTGCTTGAT GGAGACGAAG ATATTGAGAA ATTTGCTACT  CCAAACATAA ATTCAGCTAG AGGATTTGAA GTCATAGATA GAATCAAAAG TTCAGTGGAG AGTTCATGTA GTGGAGTTGT GTCTTGTGCT GATATATTAG CCATAGTTGC TAGAGATTCT  GTTCACCTAA GTGGGGGTCC ATTTTGGTAC GTTCAGCTAG GACGCAGAGA TGGATTGGTC TCAAACAAAA CACTTGCAAA TAATGCAATT CCTTCTCCAT TTGACTCACT AGATACTATC  ATTTCCAAGT TTGATAACGT TGGTCTTAGT GTTAAAGATG TTGTTACTTT ATCAGGTGCC CACACTATTG GACGAGCTAG GTGCACATTT TTTAGCAACA GATTATTCAA CTTCTCTGGA  ACACAAGAAC CAGACAATTC TTTAGAATAT GAAATGCTAA CTGAATTGCA AAACTTGTGT CCACAAGATG GAGATGGTAA CACAACTACT GTTCTTGACC CCTACTCATT TGATCAATTT  GATAACAATT ACTTCAAGAA TTTACTTAAT GGAAAGGGTC TCCTTAGCTC TGACCAAATT CTCTTTTCAA GTGATGAAGA AACCACTTCA ACCACTAAAC AATTGGTCCA ATATTATAGT  GAGAATGAAA GAATTTTTTT TATGGAATTT GCATATGCTA TGATTAAGAT GGGGAATATA AATCCACTTA TTGGTTCTGA GGGAGAGATT AGAAAGAGCT GTAGAGTGAT TAATTCTTAA  TTATGATTCT ATGTAATTAA AATGAAAGGG TTGTAGGTGT GCCCATGTAT ATTTCATGGC CAAAATGTCA CACTGGGTGG TCACTACTCC TTGCTTTGGG GTATTTGAAA TGAATAAAAT 
CTAAATAAAA GTCTTATTTA ATTCCATTTT TCATGAGATT CTTGCCAAAG ATCTCACTAC TACTCCTTGT TTTGGTGTAT TTTATATGAA TAAAGTTTAA ATG 

Retrieve as FASTA