Entry information : TaPrx112-1D (pxc1A)
Entry ID 3588
Creation 2006-09-06 (Christophe Dunand)
Last sequence changes 2014-06-18 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-06-18 (Christophe Dunand)
Peroxidase information: TaPrx112-1D (pxc1A)
Name (synonym) TaPrx112-1D (pxc1A)
Class Class III peroxidase    [Orthogroup: Prx046]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Triticum
Organism Triticum aestivum (bread wheat)    [TaxId: 4565 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TaPrx112-1D
start..stop
S start..stop
AvePrx112-1D 568 0 1..314 1..314
AvePrx112-1B 566 0 1..314 1..314
TaPrx112-1B 565 0 1..314 1..314
AvePrx112-1A 563 0 1..314 1..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 684..894 211 N° 2 1023..1197 175 N° 3 1292..1850 559  
join(684..894,1023..1197,1292..1850)


exon

Literature and cross-references TaPrx112-1D (pxc1A)
Literature Cheng D.W., Armstrong K.C. Direct capture and cloning of receptor kinase and peroxidase genes from genomic DNA. Genome 45:977-983(2002).
Protein ref. UniProtKB:   Q8LLM5
DNA ref. GenBank:   AF387866.1
Protein sequence: TaPrx112-1D (pxc1A)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314 (291)
PWM (Da):   %s   32318.15 (30200.1)  
PI (pH):   %s   8.65 (8.76) Peptide Signal:   %s   cut: 24 range:24-314
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMGSASCISLVVLVALATAATGQLSSTFYDTSCPRALATIKSGVAAAVSSDPRMGASLLRLHFHDCFVQGCDASVLLSGMEQNAGPNVGSLRGFGVIDSIKTQLESICKQTVSCADILTVAAATPSSPLKGRHGLVPLGRRDSTTASAALANSDLPGPGSSRSQLEAAFLKKNLNTVDMVALSGAHTIGKAQCSNFRTRIYGGATNINTAFATSLKANCPQSGGNGNLANLDTTTPNTFDNAYYTNLLSQKGLLHSDQVLFNNDTTDNTVRNFASNAAAFSSAFTTAMIKMGNIAPLTGTQGQIRLSCSKVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST. Dexter cultivar.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATGGGTTCTGCCTCTTGCATTTCTCTGGTGGTGCTCGTGGCTCTGGCCACGGCGGCCACGGGGCAGCTCTCGTCGACGTTCTACGACACGTCGTGTCCCAGGGCTCTGGCCACC
ATCAAGAGCGGCGTGGCGGCCGCCGTGAGCAGCGACCCCCGCATGGGCGCGTCCCTGCTCAGGCTTCACTTCCACGACTGCTTTGTCCAAG
CAAGTTTCACATAATATATCGGCTCTTTT
TATCTTAACTAACTTTGCTTTAACAGCTGTGTCCTATCTAACAAGCTTTGATTTAACAAAATTTATACCGTGAACTAATATGTTTATGTTGGCTACAGGGCTGTGATGCATCTGTTCTGC
TGTCTGGCATGGAACAAAACGCGGGTCCGAACGTGGGGTCGCTGAGAGGCTTCGGCGTCATCGACAGCATCAAGACCCAGCTGGAGAGTATATGCAAGCAGACCGTCTCCTGCGCCGACA
TCCTCACCGTCGCCGCCGCGACTCCGTCGTCGCC
GTAAAATCATCTTAGCACATTCAAGTTGCATATATGATCGATGCTACGTAAAGCTAGTAGTCCCGTACTTAATTTCTTTGGNTGGT
CGATGCAGCTTGAAGGGCCGTCATGGACTTGTTCCACTTGGGAGACGGGACTCCACCACCGCAAGTGCGGCGCTGGCGAACAGCGACCTCCCAGGCCCTGGCTCCAGCCGGTCACAGCTC
GAGGCCGCGTTCCTCAAGAAGAACCTTAACACGGTCGACATGGTCGCGCTCTCAGGCGCGCACACCATCGGGAAGGCCCAGTGCTCCAACTTCCGGACTCGAATCTACGGCGGTGCCACC
AACATCAACACTGCCTTCGCGACGTCTCTCAAGGCCAACTGCCCCCAGTCCGGCGGCAACGGCAACCTGGCGAACCTGGACACGACGACGCCCAACACGTTCGACAACGCCTACTACACC
AACCTCCTGTCACAGAAAGGGCTCCTGCATTCGGACCAGGTGCTCTTCAACAACGACACCACCGACAACACTGTCCGCAACTTTGCGTCCAACGCGGCGGCCTTCAGCAGCGCCTTCACG
ACGGCCATGATCAAGATGGGAAACATCGCGCCGCTCACCGGGACGCAGGGCCAGATCAGGCTCAGCTGCTCCAAGGTGAACTCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATGGGTTCTGCCTCTTGCATTTCTCTGGTGGTGCTCGTGGCTCTGGCCACGGCGGCCACGGGGCAGCTCTCGTCGACGTTCTACGACACGTCGTGTCCCAGGGCTCTGGCCACC
ATCAAGAGCGGCGTGGCGGCCGCCGTGAGCAGCGACCCCCGCATGGGCGCGTCCCTGCTCAGGCTTCACTTCCACGACTGCTTTGTCCAAG
GCTGTGATGCATCTGTTCTGCTGTCTGGC
ATGGAACAAAACGCGGGTCCGAACGTGGGGTCGCTGAGAGGCTTCGGCGTCATCGACAGCATCAAGACCCAGCTGGAGAGTATATGCAAGCAGACCGTCTCCTGCGCCGACATCCTCACC
GTCGCCGCCGCGACTCCGTCGTCGCC
CTTGAAGGGCCGTCATGGACTTGTTCCACTTGGGAGACGGGACTCCACCACCGCAAGTGCGGCGCTGGCGAACAGCGACCTCCCAGGCCCTGGC
TCCAGCCGGTCACAGCTCGAGGCCGCGTTCCTCAAGAAGAACCTTAACACGGTCGACATGGTCGCGCTCTCAGGCGCGCACACCATCGGGAAGGCCCAGTGCTCCAACTTCCGGACTCGA
ATCTACGGCGGTGCCACCAACATCAACACTGCCTTCGCGACGTCTCTCAAGGCCAACTGCCCCCAGTCCGGCGGCAACGGCAACCTGGCGAACCTGGACACGACGACGCCCAACACGTTC
GACAACGCCTACTACACCAACCTCCTGTCACAGAAAGGGCTCCTGCATTCGGACCAGGTGCTCTTCAACAACGACACCACCGACAACACTGTCCGCAACTTTGCGTCCAACGCGGCGGCC
TTCAGCAGCGCCTTCACGACGGCCATGATCAAGATGGGAAACATCGCGCCGCTCACCGGGACGCAGGGCCAGATCAGGCTCAGCTGCTCCAAGGTGAACTCGTGA

Retrieve as FASTA